Transcript: Human NM_001287761.1

Homo sapiens solute carrier family 28 member 1 (SLC28A1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-19
Taxon:
Homo sapiens (human)
Gene:
SLC28A1 (9154)
Length:
2155
CDS:
108..1559

Additional Resources:

NCBI RefSeq record:
NM_001287761.1
NBCI Gene record:
SLC28A1 (9154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445973 AGAGCGACTTCTCCCAGATAG pLKO_005 1294 CDS 100% 10.800 15.120 N SLC28A1 n/a
2 TRCN0000043568 GCAGCAGTAGCTTTGAGATTT pLKO.1 1435 CDS 100% 13.200 9.240 N SLC28A1 n/a
3 TRCN0000437000 TGTTCGTCGCTCTCCTCTTTG pLKO_005 667 CDS 100% 10.800 7.560 N SLC28A1 n/a
4 TRCN0000043569 CTCCTCGTCATCAGAACAGAA pLKO.1 762 CDS 100% 4.950 3.465 N SLC28A1 n/a
5 TRCN0000043572 CCTGGACAACTGCTGTCGGTT pLKO.1 1511 CDS 100% 0.880 0.616 N SLC28A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287761.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07368 pDONR223 100% 74.4% 74.4% None 1083_1084ins498 n/a
2 ccsbBroad304_07368 pLX_304 0% 74.4% 74.4% V5 1083_1084ins498 n/a
3 TRCN0000469767 GCTGGTTTTTTTGTTTTAACAGAT pLX_317 20.4% 74.4% 74.4% V5 1083_1084ins498 n/a
4 TRCN0000488389 TAACTGTGGTCTTTGATTAAGTCC pLX_317 14.6% 74.4% 74.4% V5 (not translated due to prior stop codon) 1083_1084ins498 n/a
5 TRCN0000491748 ATTATGCAAACGGGTAGTGATCTT pLX_317 14.6% 74.4% 74.4% V5 (not translated due to prior stop codon) 1083_1084ins498 n/a
Download CSV