Transcript: Human NM_001288582.2

Homo sapiens tetratricopeptide repeat domain 14 (TTC14), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TTC14 (151613)
Length:
2823
CDS:
100..2061

Additional Resources:

NCBI RefSeq record:
NM_001288582.2
NBCI Gene record:
TTC14 (151613)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288582.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230415 ATATTGAGCGTGGTGATATAG pLKO_005 464 CDS 100% 13.200 18.480 N TTC14 n/a
2 TRCN0000148304 CACTTGAAATACCGGATGATT pLKO.1 1847 CDS 100% 5.625 7.875 N TTC14 n/a
3 TRCN0000230416 ACCACACCTATCTGGTATTAA pLKO_005 738 CDS 100% 15.000 10.500 N TTC14 n/a
4 TRCN0000218417 AGGAGAAGTGTTGAGCTAAAT pLKO_005 799 CDS 100% 13.200 9.240 N TTC14 n/a
5 TRCN0000149892 GCCACCTTTAGAGCAATTCAT pLKO.1 402 CDS 100% 5.625 3.938 N TTC14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288582.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05053 pDONR223 100% 81% 74.2% None (many diffs) n/a
2 ccsbBroad304_05053 pLX_304 0% 81% 74.2% V5 (many diffs) n/a
3 TRCN0000467798 TCTAAGTAAAGCATAAAATGGTCC pLX_317 18.6% 81% 74.2% V5 (many diffs) n/a
Download CSV