Transcript: Mouse NM_001288618.1

Mus musculus corticotropin releasing hormone receptor 2 (Crhr2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Crhr2 (12922)
Length:
2700
CDS:
176..1471

Additional Resources:

NCBI RefSeq record:
NM_001288618.1
NBCI Gene record:
Crhr2 (12922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001288618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221321 CATTACCGAATCGCCCTCATT pLKO.1 569 CDS 100% 4.950 6.930 N Crhr2 n/a
2 TRCN0000221319 CGAGTACTTCAATGGCATCAA pLKO.1 430 CDS 100% 4.950 3.960 N Crhr2 n/a
3 TRCN0000221318 CCACAATTCAAGCAACGAGAT pLKO.1 2297 3UTR 100% 4.050 3.240 N Crhr2 n/a
4 TRCN0000436915 GGATCCTGATGACGAAGTTAC pLKO_005 1098 CDS 100% 10.800 7.560 N Crhr2 n/a
5 TRCN0000221322 GCAGTTGGCAAACTCTACTAT pLKO.1 962 CDS 100% 5.625 3.938 N Crhr2 n/a
6 TRCN0000221320 CCAGATTGTGTTCATCTACTT pLKO.1 1243 CDS 100% 4.950 3.465 N Crhr2 n/a
7 TRCN0000422709 GGCAAGGAAGCTGGTGATTTG pLKO_005 1004 CDS 100% 10.800 6.480 N Crhr2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489107 TTCTTTCATCGTCTTCAACTGTAG pLX_317 30.2% 82.3% 80.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488620 CCAATATACCCTTACAGTAGAAGT pLX_317 21.1% 82.2% 80.1% V5 (many diffs) n/a
Download CSV