Transcript: Human NM_001288706.2

Homo sapiens interleukin 1 receptor type 1 (IL1R1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
IL1R1 (3554)
Length:
4959
CDS:
228..1844

Additional Resources:

NCBI RefSeq record:
NM_001288706.2
NBCI Gene record:
IL1R1 (3554)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059258 CCCGTGAACTTCCTTTGACTT pLKO.1 4525 3UTR 100% 4.950 6.930 N IL1R1 n/a
2 TRCN0000360073 ATAATGCACAAGCCATATTTA pLKO_005 592 CDS 100% 15.000 10.500 N IL1R1 n/a
3 TRCN0000360115 TGGTATAGATGCAGCATATAT pLKO_005 1181 CDS 100% 15.000 10.500 N IL1R1 n/a
4 TRCN0000360113 AGGATTCAGGACATTACTATT pLKO_005 493 CDS 100% 13.200 9.240 N IL1R1 n/a
5 TRCN0000360114 GTGCTTAATATATCGGAAATT pLKO_005 1110 CDS 100% 13.200 9.240 N IL1R1 n/a
6 TRCN0000059260 GCCAAGAATACACATGGTATA pLKO.1 1167 CDS 100% 10.800 7.560 N IL1R1 n/a
7 TRCN0000059259 GCCATATTTAAGCAGAAACTA pLKO.1 603 CDS 100% 5.625 3.938 N IL1R1 n/a
8 TRCN0000059262 CCCGGGTAATAGAATTTATTA pLKO.1 856 CDS 100% 1.500 1.050 N IL1R1 n/a
9 TRCN0000059261 GCTCTTGTTCAGGATGGAATT pLKO.1 1563 CDS 100% 0.000 0.000 N IL1R1 n/a
10 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 2088 3UTR 100% 4.950 2.475 Y NPHS1 n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2254 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288706.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00844 pDONR223 100% 94.5% 94.5% None 1131_1132ins93 n/a
2 ccsbBroad304_00844 pLX_304 0% 94.5% 94.5% V5 1131_1132ins93 n/a
Download CSV