Transcript: Human NM_001288713.1

Homo sapiens neural EGFL like 1 (NELL1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
NELL1 (4745)
Length:
3354
CDS:
174..2690

Additional Resources:

NCBI RefSeq record:
NM_001288713.1
NBCI Gene record:
NELL1 (4745)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373039 GTCGACTGTAACAGGATTTAT pLKO_005 750 CDS 100% 15.000 21.000 N NELL1 n/a
2 TRCN0000373038 ATGACCATCCAACGTGATTAA pLKO_005 2729 3UTR 100% 13.200 18.480 N NELL1 n/a
3 TRCN0000054268 GCGAGAAAGATATTGATGAAT pLKO.1 1894 CDS 100% 5.625 7.875 N NELL1 n/a
4 TRCN0000054269 CGGTATCACTACATACACAAT pLKO.1 633 CDS 100% 4.950 6.930 N NELL1 n/a
5 TRCN0000054271 CCAGGATACATTCGTGTGGAT pLKO.1 1647 CDS 100% 2.640 3.696 N NELL1 n/a
6 TRCN0000054272 CCTGCAAGGATGGCAAGATAT pLKO.1 2230 CDS 100% 13.200 9.240 N NELL1 n/a
7 TRCN0000373092 TCAACCTTCCTGGGTTATATC pLKO_005 1612 CDS 100% 13.200 9.240 N NELL1 n/a
8 TRCN0000054270 GCTATGGTGTTTCACGGCTTA pLKO.1 2566 CDS 100% 4.050 2.835 N NELL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06631 pDONR223 100% 96.5% 96.5% None 54_137del;329G>A;1941C>T n/a
2 ccsbBroad304_06631 pLX_304 0% 96.5% 96.5% V5 54_137del;329G>A;1941C>T n/a
3 TRCN0000473569 CGTTCGCTGCTCCCCGTGCCCCAG pLX_317 19% 96.5% 96.5% V5 54_137del;329G>A;1941C>T n/a
Download CSV