Transcript: Human NM_001288977.2

Homo sapiens X-ray repair cross complementing 6 (XRCC6), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
XRCC6 (2547)
Length:
1999
CDS:
67..1773

Additional Resources:

NCBI RefSeq record:
NM_001288977.2
NBCI Gene record:
XRCC6 (2547)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039610 CGTCAGATTATACTGGAGAAA pLKO.1 916 CDS 100% 4.950 6.930 N XRCC6 n/a
2 TRCN0000332966 CGTCAGATTATACTGGAGAAA pLKO_005 916 CDS 100% 4.950 6.930 N XRCC6 n/a
3 TRCN0000039608 CGACATAAGTCGAGGGACTTT pLKO.1 1878 3UTR 100% 0.495 0.693 N XRCC6 n/a
4 TRCN0000009846 GAAGAGTCTACCCGACATAAG pLKO.1 1866 3UTR 100% 10.800 7.560 N XRCC6 n/a
5 TRCN0000353003 GAAGAGTCTACCCGACATAAG pLKO_005 1866 3UTR 100% 10.800 7.560 N XRCC6 n/a
6 TRCN0000039611 CCCAAGGTTGAAGCAATGAAT pLKO.1 1468 CDS 100% 5.625 3.938 N XRCC6 n/a
7 TRCN0000332902 CCCAAGGTTGAAGCAATGAAT pLKO_005 1468 CDS 100% 5.625 3.938 N XRCC6 n/a
8 TRCN0000039609 GATGAGTCATAAGAGGATCAT pLKO.1 423 CDS 100% 4.950 3.465 N XRCC6 n/a
9 TRCN0000332901 GATGAGTCATAAGAGGATCAT pLKO_005 423 CDS 100% 4.950 3.465 N XRCC6 n/a
10 TRCN0000039612 GCTGGATAATCCAGGTGCAAA pLKO.1 264 CDS 100% 4.950 3.465 N XRCC6 n/a
11 TRCN0000010371 CACATACAGAAGTGACAGCTT pLKO.1 1356 CDS 100% 2.640 1.848 N XRCC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288977.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00604 pDONR223 100% 93.2% 93.2% None 192_193ins123 n/a
2 ccsbBroad304_00604 pLX_304 0% 93.2% 93.2% V5 192_193ins123 n/a
3 ccsbBroadEn_06236 pDONR223 100% 93.1% 93.2% None 9G>C;192_193ins123;1656G>T n/a
4 ccsbBroad304_06236 pLX_304 0% 93.1% 93.2% V5 9G>C;192_193ins123;1656G>T n/a
5 TRCN0000472293 CCTCGTCTTGCTTAAGGATTCAAA pLX_317 28.9% 93.1% 93.2% V5 9G>C;192_193ins123;1656G>T n/a
Download CSV