Transcript: Human NM_001289073.2

Homo sapiens helicase, lymphoid specific (HELLS), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
HELLS (3070)
Length:
3063
CDS:
484..2586

Additional Resources:

NCBI RefSeq record:
NM_001289073.2
NBCI Gene record:
HELLS (3070)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289073.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000310 GAATATGAAGTGCCGTCTAAT pLKO.1 1149 CDS 100% 13.200 18.480 N HELLS n/a
2 TRCN0000273218 GAATATGAAGTGCCGTCTAAT pLKO_005 1149 CDS 100% 13.200 18.480 N HELLS n/a
3 TRCN0000000308 GTTGTTGTTTATCGCCTTGTT pLKO.1 2218 CDS 100% 4.950 6.930 N HELLS n/a
4 TRCN0000000307 GCCAGATGTATTTGATGACTT pLKO.1 1272 CDS 100% 4.950 3.960 N HELLS n/a
5 TRCN0000273143 GCCAGATGTATTTGATGACTT pLKO_005 1272 CDS 100% 4.950 3.960 N HELLS n/a
6 TRCN0000273147 GAACAAAGAAGTATCCATATT pLKO_005 2753 3UTR 100% 13.200 9.240 N HELLS n/a
7 TRCN0000273217 GATCAAGAGAGAAGGTCATTA pLKO_005 2426 CDS 100% 13.200 9.240 N HELLS n/a
8 TRCN0000000306 GAAGTGAATATCCCTGTAGAA pLKO.1 1708 CDS 100% 4.950 3.465 N HELLS n/a
9 TRCN0000273219 GAAGTGAATATCCCTGTAGAA pLKO_005 1708 CDS 100% 4.950 3.465 N HELLS n/a
10 TRCN0000000309 TCCAGTGAGAAAGAAACAATT pLKO.1 1549 CDS 100% 13.200 7.920 N HELLS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289073.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10871 pDONR223 100% 49.7% 49.7% None 1_1056del n/a
2 ccsbBroad304_10871 pLX_304 0% 49.7% 49.7% V5 1_1056del n/a
3 TRCN0000478779 TCTCAGACAGATCTATGCCGGTGC pLX_317 27.1% 49.7% 49.7% V5 1_1056del n/a
Download CSV