Transcript: Human NM_001289128.1

Homo sapiens interferon alpha and beta receptor subunit 2 (IFNAR2), transcript variant 6, mRNA.

Source:
NCBI, updated 2018-10-21
Taxon:
Homo sapiens (human)
Gene:
IFNAR2 (3455)
Length:
2835
CDS:
406..1125

Additional Resources:

NCBI RefSeq record:
NM_001289128.1
NBCI Gene record:
IFNAR2 (3455)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263035 GAGTGGAAATTTCACCTATAT pLKO_005 972 CDS 100% 13.200 18.480 N IFNAR2 n/a
2 TRCN0000263033 TGTATATCAGCCTCGTGTTTG pLKO_005 461 CDS 100% 10.800 15.120 N IFNAR2 n/a
3 TRCN0000263037 GCAAATACCACAAGATCATTT pLKO_005 661 CDS 100% 13.200 10.560 N IFNAR2 n/a
4 TRCN0000058784 CGCCTGATTACACAGATGAAT pLKO.1 497 CDS 100% 5.625 4.500 N IFNAR2 n/a
5 TRCN0000263034 CAAGATATCATTGCGAAATTT pLKO_005 528 CDS 100% 15.000 10.500 N IFNAR2 n/a
6 TRCN0000058785 CCATCTTATCATGGGAATTAA pLKO.1 554 CDS 100% 15.000 10.500 N IFNAR2 n/a
7 TRCN0000058786 CCATCTATTGTTGAGGAAGAA pLKO.1 868 CDS 100% 4.950 3.465 N IFNAR2 n/a
8 TRCN0000058783 GCAGTAATAAAGTCTCCCTTA pLKO.1 1060 CDS 100% 4.050 2.835 N IFNAR2 n/a
9 TRCN0000058787 CCAGAAGATTTGAAGGTGGTT pLKO.1 631 CDS 100% 2.640 1.848 N IFNAR2 n/a
10 TRCN0000263036 AGAAGCATAAACCCGAAATAA pLKO_005 941 CDS 100% 15.000 9.000 N IFNAR2 n/a
11 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 2269 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06431 pDONR223 100% 71.5% 71.2% None 28T>G;712_714delTTT;717_718ins279 n/a
2 ccsbBroad304_06431 pLX_304 0% 71.5% 71.2% V5 28T>G;712_714delTTT;717_718ins279 n/a
3 TRCN0000466854 CGCAGCTATACAGAGGGGCACGCA pLX_317 31.1% 71.5% 71.2% V5 28T>G;712_714delTTT;717_718ins279 n/a
Download CSV