Transcript: Human NM_001289164.3

Homo sapiens lysyl oxidase like 3 (LOXL3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
LOXL3 (84695)
Length:
3254
CDS:
80..1906

Additional Resources:

NCBI RefSeq record:
NM_001289164.3
NBCI Gene record:
LOXL3 (84695)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289164.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046211 CGGTATGAGTGTGCCAACTTT pLKO.1 1595 CDS 100% 5.625 7.875 N LOXL3 n/a
2 TRCN0000299631 CGGTATGAGTGTGCCAACTTT pLKO_005 1595 CDS 100% 5.625 7.875 N LOXL3 n/a
3 TRCN0000303670 ACTGGGACTCTGGGAATATAA pLKO_005 1071 CDS 100% 15.000 10.500 N LOXL3 n/a
4 TRCN0000303671 CATCTTCACTCACTATGATAT pLKO_005 1486 CDS 100% 13.200 9.240 N LOXL3 n/a
5 TRCN0000046210 CCAGACCAGCAACCAGATTAT pLKO.1 1882 CDS 100% 13.200 9.240 N LOXL3 n/a
6 TRCN0000303739 GGACCCACAGTGCCAAATATG pLKO_005 360 CDS 100% 13.200 9.240 N LOXL3 n/a
7 TRCN0000303672 TTACCAACAATGCAATGAAAT pLKO_005 1761 CDS 100% 13.200 9.240 N LOXL3 n/a
8 TRCN0000341035 GAGGGCCACAAAGCTAGTTTC pLKO_005 1535 CDS 100% 10.800 7.560 N Loxl3 n/a
9 TRCN0000046212 CCGAGCAGAGTGTGACTGAAT pLKO.1 429 CDS 100% 4.950 3.465 N LOXL3 n/a
10 TRCN0000046208 CCAGGTTGTCATCAACCCAAA pLKO.1 1717 CDS 100% 0.405 0.284 N LOXL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289164.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12839 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12839 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468852 ACCGGGGCCACAGCCACGAGAGTT pLX_317 20% 100% 100% V5 n/a
Download CSV