Transcript: Mouse NM_001289546.1

Mus musculus amphiphysin (Amph), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Amph (218038)
Length:
3247
CDS:
83..2155

Additional Resources:

NCBI RefSeq record:
NM_001289546.1
NBCI Gene record:
Amph (218038)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093273 GCTAGTCCCAACCACACATTA pLKO.1 905 CDS 100% 13.200 18.480 N Amph n/a
2 TRCN0000380846 AGCGAACTCTGATGAACTTAA pLKO_005 1972 CDS 100% 13.200 10.560 N Amph n/a
3 TRCN0000093271 CTGATGAACTTAACCTACAAA pLKO.1 1980 CDS 100% 5.625 4.500 N Amph n/a
4 TRCN0000380658 CAAGAAGAGTTGCCGTCATTG pLKO_005 644 CDS 100% 10.800 7.560 N Amph n/a
5 TRCN0000093272 GAAGAGTTCAATGTTGACTTA pLKO.1 623 CDS 100% 4.950 3.465 N Amph n/a
6 TRCN0000093270 GCCTCAATGAAGCTCACTGAA pLKO.1 299 CDS 100% 4.950 3.465 N Amph n/a
7 TRCN0000093269 GCAGTCATCATTCCTGCCTTT pLKO.1 3012 3UTR 100% 4.050 2.835 N Amph n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05811 pDONR223 100% 83% 85% None (many diffs) n/a
2 ccsbBroad304_05811 pLX_304 0% 83% 85% V5 (many diffs) n/a
3 TRCN0000476974 ACACGTGTGAATGGGACAGACCTT pLX_317 14.3% 83% 85% V5 (many diffs) n/a
Download CSV