Transcript: Mouse NM_001289583.1

Mus musculus synaptotagmin-like 2 (Sytl2), transcript variant 6, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Sytl2 (83671)
Length:
4779
CDS:
755..3607

Additional Resources:

NCBI RefSeq record:
NM_001289583.1
NBCI Gene record:
Sytl2 (83671)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380772 CACAGTCTGGGACCATTATAA pLKO_005 3394 CDS 100% 15.000 21.000 N Sytl2 n/a
2 TRCN0000379670 CAACGAGATATTGCGGTATAA pLKO_005 2890 CDS 100% 13.200 18.480 N Sytl2 n/a
3 TRCN0000381173 AGATCACTCCTTGCAACAAAC pLKO_005 1261 CDS 100% 10.800 15.120 N Sytl2 n/a
4 TRCN0000093351 CCGACCAAGAACCAGATACAA pLKO.1 2379 CDS 100% 5.625 7.875 N Sytl2 n/a
5 TRCN0000093350 GCTAGGAAATTGCCTTCCAAA pLKO.1 2264 CDS 100% 4.950 6.930 N Sytl2 n/a
6 TRCN0000093353 GCAATTCTTAAAGACGCAGAA pLKO.1 2920 CDS 100% 4.050 5.670 N Sytl2 n/a
7 TRCN0000380782 GCACGACTCAAGGGAGTTAAA pLKO_005 3754 3UTR 100% 13.200 10.560 N Sytl2 n/a
8 TRCN0000093352 CCCAGCTCATTAACCAATCTT pLKO.1 2579 CDS 100% 5.625 4.500 N Sytl2 n/a
9 TRCN0000382093 CTCAGAGACCCTCCGTTTAAA pLKO_005 1606 CDS 100% 15.000 10.500 N Sytl2 n/a
10 TRCN0000381381 AGCTCACTAGAGCCGTTAAAG pLKO_005 1727 CDS 100% 13.200 9.240 N Sytl2 n/a
11 TRCN0000379936 AGCTTCCAGTGTGATTGATAT pLKO_005 1159 CDS 100% 13.200 9.240 N Sytl2 n/a
12 TRCN0000381735 GAGTTGGCCTCATGGACAAAT pLKO_005 3664 3UTR 100% 13.200 9.240 N Sytl2 n/a
13 TRCN0000381776 GCGCTCAGATCCGTATGTAAA pLKO_005 2791 CDS 100% 13.200 9.240 N Sytl2 n/a
14 TRCN0000380365 GGAGCAAGACGCCATCTTAAA pLKO_005 784 CDS 100% 13.200 9.240 N Sytl2 n/a
15 TRCN0000380108 GGCTCCAAGAGGGATCCTAAA pLKO_005 1558 CDS 100% 10.800 7.560 N Sytl2 n/a
16 TRCN0000093349 CCGACATTCAAGGAGAGAGTT pLKO.1 3816 3UTR 100% 4.950 3.465 N Sytl2 n/a
17 TRCN0000059949 CGGGATACATTTAAGCGCAAT pLKO.1 2963 CDS 100% 4.050 5.670 N SYTL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289583.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08416 pDONR223 100% 35.3% 37.5% None (many diffs) n/a
2 ccsbBroad304_08416 pLX_304 0% 35.3% 37.5% V5 (many diffs) n/a
3 TRCN0000467832 ATCTGAGAGGATTAGAATCCCTTC pLX_317 34.8% 35.3% 37.5% V5 (many diffs) n/a
Download CSV