Transcript: Mouse NM_001289622.1

Mus musculus myoneurin (Mynn), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Mynn (80732)
Length:
5420
CDS:
853..2343

Additional Resources:

NCBI RefSeq record:
NM_001289622.1
NBCI Gene record:
Mynn (80732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348181 TCTTACCCTGCGAGATTATAA pLKO_005 942 CDS 100% 15.000 12.000 N Mynn n/a
2 TRCN0000081714 CGGGATTTCTTTGCGACTGTA pLKO.1 699 5UTR 100% 4.950 3.960 N Mynn n/a
3 TRCN0000348113 CTACCGAAATATCTAGTATTA pLKO_005 887 CDS 100% 13.200 9.240 N Mynn n/a
4 TRCN0000348180 GTAGAAGAGGTAGTAACTAAA pLKO_005 820 5UTR 100% 13.200 9.240 N Mynn n/a
5 TRCN0000081716 CCTGTAGTAGAGCAAATCATT pLKO.1 1171 CDS 100% 5.625 3.938 N Mynn n/a
6 TRCN0000081717 CCTCACCTGTAGTAGAGCAAA pLKO.1 1166 CDS 100% 4.950 3.465 N Mynn n/a
7 TRCN0000333941 CCTCACCTGTAGTAGAGCAAA pLKO_005 1166 CDS 100% 4.950 3.465 N Mynn n/a
8 TRCN0000081715 GCTGACTATCTCAAAGTAGAA pLKO.1 805 5UTR 100% 4.950 3.465 N Mynn n/a
9 TRCN0000081713 GCAACACACATACACACAAAT pLKO.1 3279 3UTR 100% 13.200 7.920 N Mynn n/a
10 TRCN0000334018 GCAACACACATACACACAAAT pLKO_005 3279 3UTR 100% 13.200 7.920 N Mynn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289622.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08607 pDONR223 100% 70.4% 73.4% None (many diffs) n/a
2 ccsbBroad304_08607 pLX_304 0% 70.4% 73.4% V5 (many diffs) n/a
3 TRCN0000473910 CTTTCGTGTGTTCAGTATAAGCCT pLX_317 21.3% 70.4% 73.4% V5 (many diffs) n/a
Download CSV