Transcript: Mouse NM_001289683.1

Mus musculus proline rich Gla (G-carboxyglutamic acid) 1 (Prrg1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-16
Taxon:
Mus musculus (mouse)
Gene:
Prrg1 (546336)
Length:
3973
CDS:
240..896

Additional Resources:

NCBI RefSeq record:
NM_001289683.1
NBCI Gene record:
Prrg1 (546336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367272 CCTTTCCCTCAGCAACTTAAC pLKO_005 600 CDS 100% 10.800 15.120 N Prrg1 n/a
2 TRCN0000367271 AGGAAGTGACTGGTTTCAATT pLKO_005 461 CDS 100% 13.200 9.240 N Prrg1 n/a
3 TRCN0000367346 TCTACCACATCACCCATAAAG pLKO_005 1208 3UTR 100% 13.200 9.240 N Prrg1 n/a
4 TRCN0000367275 TTAGACCCACCACCAGAATAT pLKO_005 807 CDS 100% 13.200 9.240 N Prrg1 n/a
5 TRCN0000367345 CTGTGGTCACCACCATCAAAT pLKO_005 874 CDS 100% 13.200 7.920 N Prrg1 n/a
6 TRCN0000056434 GAAATAAGACAGGGCAACATT pLKO.1 318 CDS 100% 5.625 3.375 N PRRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289683.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01301 pDONR223 100% 90.5% 92.6% None (many diffs) n/a
2 ccsbBroad304_01301 pLX_304 0% 90.5% 92.6% V5 (many diffs) n/a
3 TRCN0000473678 TGTAACCGCAAACGGCCGGTCAAA pLX_317 32.9% 90.5% 92.6% V5 (many diffs) n/a
Download CSV