Transcript: Mouse NM_001289701.1

Mus musculus phosphodiesterase 4D interacting protein (myomegalin) (Pde4dip), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pde4dip (83679)
Length:
8413
CDS:
38..7429

Additional Resources:

NCBI RefSeq record:
NM_001289701.1
NBCI Gene record:
Pde4dip (83679)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289701.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192700 GATCTCAAGTTGAACCGACTT pLKO.1 8078 3UTR 100% 4.050 5.670 N Pde4dip n/a
2 TRCN0000282472 CACCCTGGATGAGGCATTATT pLKO_005 207 CDS 100% 15.000 12.000 N Pde4dip n/a
3 TRCN0000262999 TGACCTTCAGAGCGCTCTATT pLKO_005 1423 CDS 100% 13.200 10.560 N Pde4dip n/a
4 TRCN0000217182 CAAACCGATCAAGGTTCTATG pLKO.1 2537 CDS 100% 10.800 8.640 N Pde4dip n/a
5 TRCN0000217529 CAGGAGACAGAACACGTTTAT pLKO.1 683 CDS 100% 13.200 9.240 N Pde4dip n/a
6 TRCN0000262997 CAGGCCCGAGAACTATCATAT pLKO_005 4841 CDS 100% 13.200 9.240 N Pde4dip n/a
7 TRCN0000262998 GAAGAAGCCTGGAGCGTTTAA pLKO_005 3168 CDS 100% 13.200 9.240 N Pde4dip n/a
8 TRCN0000262996 GGCAAGCAATGACTATGATTA pLKO_005 7622 3UTR 100% 13.200 9.240 N Pde4dip n/a
9 TRCN0000192973 GCCACATCATGCCTATTGAAT pLKO.1 8160 3UTR 100% 5.625 3.938 N Pde4dip n/a
10 TRCN0000189480 CCAGAGGTCTTTGAGTCTACA pLKO.1 7996 3UTR 100% 4.950 3.465 N Pde4dip n/a
11 TRCN0000191252 CTAGCACCTTTCTTACATGAT pLKO.1 8060 3UTR 100% 4.950 3.465 N Pde4dip n/a
12 TRCN0000191645 CTTACATGATCTCAAGTTGAA pLKO.1 8071 3UTR 100% 4.950 3.465 N Pde4dip n/a
13 TRCN0000048842 GAAGGAGAACTTCAGCCTCAA pLKO.1 445 CDS 100% 4.050 2.835 N PDE4DIP n/a
14 TRCN0000189784 GACATTGTTGGCACCCAACAA pLKO.1 7896 3UTR 100% 0.495 0.347 N Pde4dip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289701.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07461 pDONR223 100% 10.1% 9.5% None (many diffs) n/a
2 ccsbBroad304_07461 pLX_304 0% 10.1% 9.5% V5 (many diffs) n/a
3 TRCN0000472710 GAATTCGTGAGATAATCGGGTTTT pLX_317 41.8% 10.1% 9.5% V5 (many diffs) n/a
4 ccsbBroadEn_11397 pDONR223 100% 6.1% 5.5% None (many diffs) n/a
5 ccsbBroad304_11397 pLX_304 0% 6.1% 5.5% V5 (many diffs) n/a
6 TRCN0000473601 TCACCCAGAGTGGGACCCCTTAAC pLX_317 81.1% 6.1% 5.5% V5 (many diffs) n/a
Download CSV