Construct: ORF TRCN0000472710
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005368.1_s317c1
- Derived from:
- ccsbBroadEn_07461
- DNA Barcode:
- GAATTCGTGAGATAATCGGGTTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PDE4DIP (9659)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472710
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | NM_022359.6 | 99.7% | 99.3% | 557T>C;738C>G |
| 2 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | NM_001195261.1 | 55% | 52.4% | (many diffs) |
| 3 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | NM_001002810.3 | 53.4% | 52.2% | (many diffs) |
| 4 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | NM_001195260.1 | 45.2% | 44.8% | 0_1ins507;50T>C;231C>G |
| 5 | human | 653513 | LOC653513 | phosphodiesterase 4D intera... | NR_037182.1 | 29.5% | (many diffs) | |
| 6 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | NM_001002812.2 | 15% | 14.6% | (many diffs) |
| 7 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_011510176.2 | 13.3% | 13.3% | 557T>C;738C>G;931_6933del |
| 8 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_024451068.1 | 13.2% | 13.2% | 557T>C;738C>G;931_6978del |
| 9 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_024451067.1 | 12.8% | 12.7% | 557T>C;738C>G;931_7248del |
| 10 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | NM_001350521.2 | 12.5% | 12.5% | 557T>C;738C>G;931_7380del |
| 11 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_011510175.2 | 12.4% | 12.4% | 557T>C;738C>G;931_7446del |
| 12 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_017002878.2 | 12.4% | 12.4% | 557T>C;738C>G;931_7449del |
| 13 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_011510173.2 | 12% | 12% | 557T>C;738C>G;931_7695del |
| 14 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_011510172.2 | 12% | 12% | 557T>C;738C>G;931_7698del |
| 15 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | NM_001198832.2 | 10.2% | 10% | (many diffs) |
| 16 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_017002903.2 | 10.2% | 10% | (many diffs) |
| 17 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | NM_001350523.1 | 10.1% | 9.9% | (many diffs) |
| 18 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_017002899.2 | 9.9% | 9.7% | (many diffs) |
| 19 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | NM_001350522.1 | 9.8% | 9.6% | (many diffs) |
| 20 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_006711646.2 | 9.2% | 9% | (many diffs) |
| 21 | human | 100996724 | LOC100996724 | phosphodiesterase 4D intera... | NR_144517.1 | 8.5% | (many diffs) | |
| 22 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_011510179.1 | 6.7% | 6.5% | (many diffs) |
| 23 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | NM_014644.5 | 6.7% | 6.5% | (many diffs) |
| 24 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | NM_001198834.3 | 6.6% | 6.4% | (many diffs) |
| 25 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_006711650.4 | 6.6% | 6.3% | (many diffs) |
| 26 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_006711652.1 | 6.5% | 6.3% | (many diffs) |
| 27 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_006711651.1 | 6.5% | 6.3% | (many diffs) |
| 28 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_017002887.1 | 5.4% | 5.4% | (many diffs) |
| 29 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_017002888.1 | 5.4% | 5.4% | (many diffs) |
| 30 | human | 9659 | PDE4DIP | phosphodiesterase 4D intera... | XM_017002889.2 | 5.4% | 5.4% | (many diffs) |
| 31 | mouse | 83679 | Pde4dip | phosphodiesterase 4D intera... | NM_001289702.1 | 10.3% | 9.7% | (many diffs) |
| 32 | mouse | 83679 | Pde4dip | phosphodiesterase 4D intera... | NM_001039376.2 | 10.1% | 9.6% | (many diffs) |
| 33 | mouse | 83679 | Pde4dip | phosphodiesterase 4D intera... | NM_001289701.1 | 10.1% | 9.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 996
- ORF length:
- 930
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gggcacagac agcgggtcct gctgccgccg ccgatgcgac tttggctgct 121 gctgtcgcgc gtcccgccgg gctcactaca cgccttaccg gtccggggac gcgacgcgaa 181 cccctcagtc cccacggcag accccgagcc gggaaagacg gcgcccggag ccagccggga 241 gctgggcagc agcggccgag gaggaagaag cagctgcggc ggccacaccc tggatgagag 301 attattttgc agaggatgat ggggagatgg tacccagaac gagtcacaca gcagcttttc 361 ttagtgacac taaagatcga ggccctccag tgcagtcaca gatctggaga agtggtgaaa 421 aggtcccgtt tgtgcagaca tattccttga gagcatttga gaaaccccct caggtacaga 481 cccaggctct tcgagacttt gagaagcacc tcaatgacct gaagaaggag aacttcagcc 541 tcaagctgcg catctacttc ctggaggagc gcatgcaaca gaagtatgag gccagccggg 601 aggacatcTA CAAGCGGAAC ACTGAGCTGA AGGTTGAAGT GGAGAGCTTG AAACGAGAAC 661 TCCAGGACAA GAAACAGCAT CTGGATAAAA CATGGGCTGA TGTGGAGAAT CTCAACAGTC 721 AGAATGAAGC TGAGCTCCGA CGCCAGTTTG AGGAGCGACA GCAGGAGACG GAGCATGTTT 781 ATGAGCTCTT GGAGAATAAG ATGCAGCTTC TGCAGGAGGA ATCCAGGCTA GCAAAGAATG 841 AAGCTGCGCG GATGGCAGCT CTGGTGGAAG CAGAGAAGGA GTGTAACCTG GAGCTCTCAG 901 AGAAACTGAA GGGAGTCACC AAAAACTGGG AAGATGTACC AGGAGACCAG GTCAAGCCCG 961 ACCAATACAC TGAGGCCCTG GCCCAGAGGG ACAAGTACCC AACTTTCTTG TACAAAGTGG 1021 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1081 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1141 AGAATTCGTG AGATAATCGG GTTTTACGCG TTAAGTCgac aatcaacctc tggattacaa 1201 aatttgtgaa agatt