Transcript: Human NM_001289993.2

Homo sapiens flagellum associated containing coiled-coil domains 1 (FLACC1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
FLACC1 (130540)
Length:
1732
CDS:
80..1348

Additional Resources:

NCBI RefSeq record:
NM_001289993.2
NBCI Gene record:
FLACC1 (130540)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419849 GTACGTATCAGGACAGTATTT pLKO_005 744 CDS 100% 13.200 18.480 N FLACC1 n/a
2 TRCN0000204294 CACAGCTTATCACGGACTCTT pLKO.1 1513 3UTR 100% 4.950 6.930 N FLACC1 n/a
3 TRCN0000162567 CGGAAGAGAACATTCATCTGA pLKO.1 1200 CDS 100% 3.000 2.400 N FLACC1 n/a
4 TRCN0000412610 GACAGCAATAATTGAACAAAT pLKO_005 490 CDS 100% 13.200 9.240 N FLACC1 n/a
5 TRCN0000161321 GCAAGGCAAGAAGAGACTAAT pLKO.1 281 CDS 100% 13.200 9.240 N FLACC1 n/a
6 TRCN0000202903 CATCTGAATTTCACAGCTTAT pLKO.1 1502 3UTR 100% 10.800 7.560 N FLACC1 n/a
7 TRCN0000418691 GAACACAAACCTCTACTATAC pLKO_005 1069 CDS 100% 10.800 7.560 N FLACC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14375 pDONR223 100% 99.7% 61.6% None 127G>C;772_773insAA n/a
2 ccsbBroad304_14375 pLX_304 0% 99.7% 61.6% V5 (not translated due to prior stop codon) 127G>C;772_773insAA n/a
3 TRCN0000480258 TAGTTGTTTCACCTAATCAATGGT pLX_317 25.9% 99.7% 61.6% V5 (not translated due to prior stop codon) 127G>C;772_773insAA n/a
Download CSV