Transcript: Human NM_001290022.1

Homo sapiens thrombopoietin (THPO), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
THPO (7066)
Length:
2178
CDS:
547..1596

Additional Resources:

NCBI RefSeq record:
NM_001290022.1
NBCI Gene record:
THPO (7066)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058809 CGGACATTTCCTCAGGAACAT pLKO.1 1349 CDS 100% 4.950 3.960 N THPO n/a
2 TRCN0000058810 GCTCCGAGGAAAGGTGCGTTT pLKO.1 999 CDS 100% 1.350 1.080 N THPO n/a
3 TRCN0000373685 GACCTCCGAGTCCTCAGTAAA pLKO_005 631 CDS 100% 13.200 9.240 N THPO n/a
4 TRCN0000058812 CCAGCCCTCTTCTAAACACAT pLKO.1 1538 CDS 100% 4.950 3.465 N THPO n/a
5 TRCN0000058808 CCCTCTTCTAAACACATCCTA pLKO.1 1542 CDS 100% 3.000 2.100 N THPO n/a
6 TRCN0000058811 CTTCTCCTAACTGCAAGGCTA pLKO.1 580 CDS 100% 2.640 1.848 N THPO n/a
7 TRCN0000373686 AGCTAGCTCTTTGGTCTATTT pLKO_005 1815 3UTR 100% 13.200 7.920 N THPO n/a
8 TRCN0000373764 CAACCTCCAGCCTGGATATTC pLKO_005 1392 CDS 100% 13.200 7.920 N THPO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290022.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01668 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01668 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480742 CATGCGGCTCTGCCTTACAATGCG pLX_317 35.3% 100% 100% V5 n/a
Download CSV