Transcript: Human NM_001290076.1

Homo sapiens upregulator of cell proliferation (URGCP), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
URGCP (55665)
Length:
3957
CDS:
518..3184

Additional Resources:

NCBI RefSeq record:
NM_001290076.1
NBCI Gene record:
URGCP (55665)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163812 CGGAGAACCACTACCATACAT pLKO.1 1047 CDS 100% 5.625 7.875 N URGCP n/a
2 TRCN0000338783 CGGAGAACCACTACCATACAT pLKO_005 1047 CDS 100% 5.625 7.875 N URGCP n/a
3 TRCN0000159784 GCACCGTATTTATTGACTGAT pLKO.1 3682 3UTR 100% 4.950 6.930 N URGCP n/a
4 TRCN0000138685 GCGCGTTGTAACTCATGTGTT pLKO.1 3801 3UTR 100% 4.950 6.930 N URGCP n/a
5 TRCN0000338714 ATGACCTTGCTGCCGACATTT pLKO_005 873 CDS 100% 13.200 10.560 N URGCP n/a
6 TRCN0000161141 CAAAGACTTGCCCTGGAATTT pLKO.1 721 CDS 100% 13.200 10.560 N URGCP n/a
7 TRCN0000161610 GCCCAACTACCAGTTTGTATA pLKO.1 2824 CDS 100% 13.200 9.240 N URGCP n/a
8 TRCN0000160688 CGCGTTGTAACTCATGTGTTT pLKO.1 3802 3UTR 100% 4.950 3.465 N URGCP n/a
9 TRCN0000350994 CGCGTTGTAACTCATGTGTTT pLKO_005 3802 3UTR 100% 4.950 3.465 N URGCP n/a
10 TRCN0000138673 GCGCAACACAAACCTGAGATT pLKO.1 1567 CDS 100% 4.950 3.465 N URGCP n/a
11 TRCN0000158774 GACTGACAATATCAGTAAGAA pLKO.1 1471 CDS 100% 0.563 0.394 N URGCP n/a
12 TRCN0000160072 CGTTATGGAGATGGTACAAAT pLKO.1 542 CDS 100% 13.200 6.600 Y URGCP n/a
13 TRCN0000338712 CGTTATGGAGATGGTACAAAT pLKO_005 542 CDS 100% 13.200 6.600 Y URGCP n/a
14 TRCN0000192637 GCAGATTTGGAATGGAGAGAA pLKO.1 497 5UTR 100% 4.950 2.475 Y Urgcp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12244 pDONR223 100% 96.2% 96.2% None (many diffs) n/a
2 ccsbBroad304_12244 pLX_304 0% 96.2% 96.2% V5 (many diffs) n/a
3 TRCN0000478939 CGCTGCTTCGAGTCATTATCGTTG pLX_317 15.2% 96.2% 96.2% V5 (many diffs) n/a
Download CSV