Transcript: Mouse NM_001290459.1

Mus musculus highly divergent homeobox (Hdx), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Hdx (245596)
Length:
4114
CDS:
141..2045

Additional Resources:

NCBI RefSeq record:
NM_001290459.1
NBCI Gene record:
Hdx (245596)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226161 TGGGATTCAAAGGTCATATAA pLKO_005 647 CDS 100% 15.000 21.000 N Hdx n/a
2 TRCN0000218272 CATCAATGGGAGCACAAATAA pLKO_005 913 CDS 100% 15.000 10.500 N Hdx n/a
3 TRCN0000226162 TAATCCATCACGGAGTAATTT pLKO_005 1142 CDS 100% 15.000 10.500 N Hdx n/a
4 TRCN0000226163 TAGGTTGTGTGGAACTATATT pLKO_005 3264 3UTR 100% 15.000 10.500 N Hdx n/a
5 TRCN0000226160 TGTCATTGTAACTGGTATATA pLKO_005 284 CDS 100% 15.000 10.500 N Hdx n/a
6 TRCN0000019282 GCCAATAATGATGTCATTGTA pLKO.1 273 CDS 100% 5.625 3.938 N HDX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290459.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04927 pDONR223 100% 82.5% 82.2% None (many diffs) n/a
2 TRCN0000477382 TCCCTCGAGGGGGTGTACCTGGAA pLX_317 20.3% 82.5% 82.2% V5 (many diffs) n/a
Download CSV