Transcript: Mouse NM_001290484.1

Mus musculus general transcription factor IIIC, polypeptide 5 (Gtf3c5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Gtf3c5 (70239)
Length:
2823
CDS:
303..1865

Additional Resources:

NCBI RefSeq record:
NM_001290484.1
NBCI Gene record:
Gtf3c5 (70239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349764 ACGGAAATTGACCTACAATAA pLKO_005 1436 CDS 100% 13.200 18.480 N Gtf3c5 n/a
2 TRCN0000086397 CGTCCTGTTTGGTCACGAAAT pLKO.1 1083 CDS 100% 10.800 15.120 N Gtf3c5 n/a
3 TRCN0000311871 CGTCCTGTTTGGTCACGAAAT pLKO_005 1083 CDS 100% 10.800 15.120 N Gtf3c5 n/a
4 TRCN0000374259 CGTTCAACTTGGAGATCATTG pLKO_005 625 CDS 100% 10.800 15.120 N Gtf3c5 n/a
5 TRCN0000086396 CCGTCCTGTTTGGTCACGAAA pLKO.1 1082 CDS 100% 4.950 6.930 N Gtf3c5 n/a
6 TRCN0000374194 GAAGCTTGTGGATTCGATTTG pLKO_005 1192 CDS 100% 10.800 8.640 N Gtf3c5 n/a
7 TRCN0000086395 GCTTCCCTATATGGCTTATTA pLKO.1 1151 CDS 100% 15.000 10.500 N Gtf3c5 n/a
8 TRCN0000349765 GCACCGAGAAGGCTATCATAA pLKO_005 869 CDS 100% 13.200 9.240 N Gtf3c5 n/a
9 TRCN0000312857 AGATTGAAGATCCATTGTTTG pLKO_005 2230 3UTR 100% 10.800 7.560 N Gtf3c5 n/a
10 TRCN0000086393 CCATTGTTTGATTTGGGTCAA pLKO.1 2241 3UTR 100% 4.050 2.835 N Gtf3c5 n/a
11 TRCN0000086394 GCCAAGATTTATCAAGTCCTT pLKO.1 1239 CDS 100% 2.640 1.848 N Gtf3c5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290484.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07389 pDONR223 100% 83.5% 85.1% None (many diffs) n/a
2 ccsbBroad304_07389 pLX_304 0% 83.5% 85.1% V5 (many diffs) n/a
3 TRCN0000465761 GGTATCCGCGATAGTTCGACGGTA pLX_317 17.6% 83.5% 85.1% V5 (many diffs) n/a
Download CSV