Transcript: Mouse NM_001290521.1

Mus musculus WD repeat domain 31 (Wdr31), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Wdr31 (71354)
Length:
2557
CDS:
309..1412

Additional Resources:

NCBI RefSeq record:
NM_001290521.1
NBCI Gene record:
Wdr31 (71354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313720 AGCGGGAAATCACGAAGATAG pLKO_005 616 CDS 100% 10.800 15.120 N Wdr31 n/a
2 TRCN0000113281 GAGCGGGAAATCACGAAGATA pLKO.1 615 CDS 100% 5.625 7.875 N Wdr31 n/a
3 TRCN0000113280 CCTCCTTGTTATGCGCAAGTT pLKO.1 1318 CDS 100% 4.950 6.930 N Wdr31 n/a
4 TRCN0000317310 CCTCCTTGTTATGCGCAAGTT pLKO_005 1318 CDS 100% 4.950 6.930 N Wdr31 n/a
5 TRCN0000113282 ACGGCCTTGATGCCTATGATT pLKO.1 1179 CDS 100% 5.625 4.500 N Wdr31 n/a
6 TRCN0000349986 GACAGAATGTGTGAGTATAAG pLKO_005 1113 CDS 100% 13.200 9.240 N Wdr31 n/a
7 TRCN0000313721 TGGATGGACACACGTGTATTT pLKO_005 1027 CDS 100% 13.200 9.240 N Wdr31 n/a
8 TRCN0000113283 CTCTGAACTCAGACCTTTGTA pLKO.1 517 CDS 100% 5.625 3.938 N Wdr31 n/a
9 TRCN0000317239 CTCTGAACTCAGACCTTTGTA pLKO_005 517 CDS 100% 5.625 3.938 N Wdr31 n/a
10 TRCN0000113284 CCACTCTGAACTCAGACCTTT pLKO.1 514 CDS 100% 4.950 3.465 N Wdr31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04673 pDONR223 100% 84.9% 82.8% None (many diffs) n/a
2 ccsbBroad304_04673 pLX_304 0% 84.9% 82.8% V5 (many diffs) n/a
3 TRCN0000470624 GCAATCACTTGGACAAACTCACCC pLX_317 41.8% 84.9% 82.8% V5 (many diffs) n/a
Download CSV