Transcript: Mouse NM_001290540.1

Mus musculus PDZ domain containing 4 (Pdzd4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pdzd4 (245469)
Length:
3646
CDS:
629..2602

Additional Resources:

NCBI RefSeq record:
NM_001290540.1
NBCI Gene record:
Pdzd4 (245469)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099136 GCATCTACGTTGGAGAGGTAA pLKO.1 771 CDS 100% 4.950 6.930 N Pdzd4 n/a
2 TRCN0000099138 CTAGAGTTCAAGTGCCGCAAT pLKO.1 1523 CDS 100% 4.050 5.670 N Pdzd4 n/a
3 TRCN0000099137 CCTTCGTGCTAGGAAGCTAAA pLKO.1 1024 CDS 100% 10.800 8.640 N Pdzd4 n/a
4 TRCN0000099135 GCTGCAATTATTTGTAGACAA pLKO.1 2982 3UTR 100% 4.950 3.465 N Pdzd4 n/a
5 TRCN0000099139 GAGCAGTACAAAGTGATGCTT pLKO.1 665 CDS 100% 3.000 2.100 N Pdzd4 n/a
6 TRCN0000161219 GAGGTAAATCCCAACAGCATT pLKO.1 785 CDS 100% 4.950 2.970 N PDZD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290540.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12372 pDONR223 100% 72.7% 78.8% None (many diffs) n/a
2 ccsbBroad304_12372 pLX_304 0% 72.7% 78.8% V5 (many diffs) n/a
3 TRCN0000469818 AAGTAATACTGAATAGACTAACGC pLX_317 21.2% 72.7% 78.8% V5 (many diffs) n/a
Download CSV