Transcript: Mouse NM_001290665.1

Mus musculus cysteine-serine-rich nuclear protein 3 (Csrnp3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Csrnp3 (77771)
Length:
10644
CDS:
348..2105

Additional Resources:

NCBI RefSeq record:
NM_001290665.1
NBCI Gene record:
Csrnp3 (77771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290665.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250827 TATCCGTGTCCGGACTCATTT pLKO_005 1130 CDS 100% 13.200 18.480 N Csrnp3 n/a
2 TRCN0000250825 TGCTGGGCTCATCGTTGTTTA pLKO_005 2164 3UTR 100% 13.200 18.480 N Csrnp3 n/a
3 TRCN0000250826 CAACACCGAAGTGGACGAATA pLKO_005 839 CDS 100% 10.800 15.120 N Csrnp3 n/a
4 TRCN0000175186 CACTAAAGAAGGCTGTAGTAA pLKO.1 1082 CDS 100% 5.625 7.875 N Csrnp3 n/a
5 TRCN0000258099 TCGCAGACAATTTCGAGATTG pLKO_005 1285 CDS 100% 10.800 8.640 N Csrnp3 n/a
6 TRCN0000250824 CCCTGACCGTGGATGACATTT pLKO_005 796 CDS 100% 13.200 9.240 N Csrnp3 n/a
7 TRCN0000193381 CTTCTATTTAAGGCACTGTAT pLKO.1 2137 3UTR 100% 4.950 3.465 N Csrnp3 n/a
8 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 1473 CDS 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290665.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.