Transcript: Mouse NM_001290721.1

Mus musculus testis specific 10 (Tsga10), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tsga10 (211484)
Length:
2723
CDS:
529..2601

Additional Resources:

NCBI RefSeq record:
NM_001290721.1
NBCI Gene record:
Tsga10 (211484)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102007 CGCCAGAATTACTCAAGCAAT pLKO.1 2476 CDS 100% 4.950 6.930 N Tsga10 n/a
2 TRCN0000102008 GCCCTCATTATGTGCGAACAA pLKO.1 1480 CDS 100% 4.950 6.930 N Tsga10 n/a
3 TRCN0000102005 GCGCTCTTACAAATCCCAGAT pLKO.1 1947 CDS 100% 4.050 3.240 N Tsga10 n/a
4 TRCN0000102006 GCCAAAGATCAGGAAATAGAA pLKO.1 2119 CDS 100% 5.625 3.938 N Tsga10 n/a
5 TRCN0000102009 CAAACTGTGATGTAGAGCTTT pLKO.1 584 CDS 100% 4.950 3.465 N Tsga10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14285 pDONR223 100% 87.8% 27.2% None (many diffs) n/a
2 ccsbBroad304_14285 pLX_304 0% 87.8% 27.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473689 CCATCAGATCATGACCTAGCGTTC pLX_317 19.9% 87.8% 27.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV