Transcript: Mouse NM_001291053.1

Mus musculus yippee like 1 (Ypel1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-24
Taxon:
Mus musculus (mouse)
Gene:
Ypel1 (106369)
Length:
2599
CDS:
199..465

Additional Resources:

NCBI RefSeq record:
NM_001291053.1
NBCI Gene record:
Ypel1 (106369)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126491 CTCGGGTGGAAATACGAACAT pLKO.1 364 CDS 100% 4.950 3.960 N Ypel1 n/a
2 TRCN0000126489 CCCAGATAAGTTTCATTGTTT pLKO.1 1364 3UTR 100% 5.625 3.938 N Ypel1 n/a
3 TRCN0000126492 CCGACATCTACTGTGAGAACT pLKO.1 332 CDS 100% 4.950 3.465 N Ypel1 n/a
4 TRCN0000156614 GCCTTTGAGAGCAGTCAGAAA pLKO.1 385 CDS 100% 4.950 2.970 N YPEL1 n/a
5 TRCN0000126490 CCTCTTCAACTCTGTGGTGAA pLKO.1 255 CDS 100% 4.050 2.430 N Ypel1 n/a
6 TRCN0000190583 GCCTACCTCTTCAACTCTGTA pLKO.1 250 CDS 100% 4.950 2.475 Y Ypel3 n/a
7 TRCN0000277326 GCCTACCTCTTCAACTCTGTA pLKO_005 250 CDS 100% 4.950 2.475 Y Ypel3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08123 pDONR223 100% 64.8% 65.5% None (many diffs) n/a
2 ccsbBroad304_08123 pLX_304 0% 64.8% 65.5% V5 (many diffs) n/a
3 TRCN0000472132 TTCAACAATTGAGCCTCATAACTA pLX_317 100% 64.8% 65.5% V5 (many diffs) n/a
4 ccsbBroadEn_05581 pDONR223 100% 60.7% 65.5% None (many diffs) n/a
5 ccsbBroad304_05581 pLX_304 0% 60.7% 65.5% V5 (many diffs) n/a
Download CSV