Transcript: Human NM_001291107.2

Homo sapiens CUGBP Elav-like family member 3 (CELF3), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CELF3 (11189)
Length:
5579
CDS:
784..2178

Additional Resources:

NCBI RefSeq record:
NM_001291107.2
NBCI Gene record:
CELF3 (11189)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425616 GAACAGTTTGGTCGGATCTTT pLKO_005 865 CDS 100% 5.625 7.875 N CELF3 n/a
2 TRCN0000429979 AGGACGTCCGGAAGATGTTTG pLKO_005 1106 CDS 100% 10.800 7.560 N CELF3 n/a
3 TRCN0000005727 CCTCAGCTAGAGGTAGGATAT pLKO.1 2655 3UTR 100% 10.800 7.560 N CELF3 n/a
4 TRCN0000005729 GCGCCTCAAAGTCCAGCTAAA pLKO.1 2127 CDS 100% 10.800 7.560 N CELF3 n/a
5 TRCN0000418643 GCGCCTCAAAGTCCAGCTAAA pLKO_005 2127 CDS 100% 10.800 7.560 N Celf3 n/a
6 TRCN0000422671 GCTTTGTGAGTTTCGACAATC pLKO_005 2051 CDS 100% 10.800 7.560 N CELF3 n/a
7 TRCN0000431535 GCTTTGTGAGTTTCGACAATC pLKO_005 2051 CDS 100% 10.800 7.560 N Celf3 n/a
8 TRCN0000412725 TGACCGAGCCACCAATCAAAG pLKO_005 2019 CDS 100% 10.800 7.560 N CELF3 n/a
9 TRCN0000005728 CGTCATCTCAGCCAAAGTCTT pLKO.1 1995 CDS 100% 4.950 3.465 N CELF3 n/a
10 TRCN0000005730 GCTGACTGTCATCAAGGACAA pLKO.1 888 CDS 100% 4.050 2.835 N CELF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11611 pDONR223 100% 99.2% 98.9% None (many diffs) n/a
2 ccsbBroad304_11611 pLX_304 0% 99.2% 98.9% V5 (many diffs) n/a
3 TRCN0000475880 TCGTGGCATCAAGGAAGATTCACG pLX_317 23.5% 99.2% 98.9% V5 (many diffs) n/a
Download CSV