Transcript: Mouse NM_001291190.1

Mus musculus slingshot homolog 2 (Drosophila) (Ssh2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ssh2 (237860)
Length:
9176
CDS:
147..4436

Additional Resources:

NCBI RefSeq record:
NM_001291190.1
NBCI Gene record:
Ssh2 (237860)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081499 CCCACATTATCCAATCGCAAA pLKO.1 2835 CDS 100% 4.050 5.670 N Ssh2 n/a
2 TRCN0000081498 GCAAAGAAACATGGATCTAAA pLKO.1 1305 CDS 100% 13.200 10.560 N Ssh2 n/a
3 TRCN0000081502 CCTGGACCTTTGTAAAGACTA pLKO.1 3959 CDS 100% 4.950 3.465 N Ssh2 n/a
4 TRCN0000081500 GCCTATGACTATGTGAAGGAA pLKO.1 1416 CDS 100% 3.000 2.100 N Ssh2 n/a
5 TRCN0000081501 GCTGACCCAAACCCTATGTTA pLKO.1 3432 CDS 100% 5.625 3.375 N Ssh2 n/a
6 TRCN0000006941 CGAGCCTATGACTATGTGAAA pLKO.1 1413 CDS 100% 4.950 3.465 N SSH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488828 AACTGCCTATCTGGCAAAGACCTC pLX_317 20.6% 30.5% 29.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_12916 pDONR223 100% 11% 11.3% None (many diffs) n/a
3 ccsbBroad304_12916 pLX_304 0% 11% 11.3% V5 (many diffs) n/a
4 TRCN0000467800 CCATCTTGTACCCAATCACTGTTA pLX_317 63.5% 11% 11.3% V5 (many diffs) n/a
Download CSV