Transcript: Mouse NM_001291211.1

Mus musculus protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 (Pcmtd2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pcmtd2 (245867)
Length:
3572
CDS:
340..1170

Additional Resources:

NCBI RefSeq record:
NM_001291211.1
NBCI Gene record:
Pcmtd2 (245867)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249277 CTATTGATCGAGCAGATTATT pLKO_005 443 CDS 100% 15.000 21.000 N Pcmtd2 n/a
2 TRCN0000249278 TTGTCAGTATGATCGTGTTTA pLKO_005 810 CDS 100% 13.200 18.480 N Pcmtd2 n/a
3 TRCN0000257882 AGCGACAGCTTTGACAAATTT pLKO_005 733 CDS 100% 15.000 10.500 N Pcmtd2 n/a
4 TRCN0000249279 CCAAGTTAGAGTACTAATTTA pLKO_005 2490 3UTR 100% 15.000 10.500 N Pcmtd2 n/a
5 TRCN0000215894 CAACGATGAGCTCATTGATAA pLKO.1 369 CDS 100% 13.200 9.240 N Pcmtd2 n/a
6 TRCN0000249280 TGAAGAACACACCTATGTTTA pLKO_005 1149 CDS 100% 13.200 9.240 N Pcmtd2 n/a
7 TRCN0000179539 GCTCCAGATTGTTGTCAGTAT pLKO.1 799 CDS 100% 4.950 3.465 N Pcmtd2 n/a
8 TRCN0000216327 GAAGAACACACCTATGTTTAA pLKO.1 1150 CDS 100% 13.200 7.920 N Pcmtd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03563 pDONR223 100% 65.1% 50% None (many diffs) n/a
2 ccsbBroad304_03563 pLX_304 0% 65.1% 50% V5 (many diffs) n/a
3 TRCN0000472521 TCGCCTAACAACGGCCTAGTCTGC pLX_317 38.8% 65.1% 50% V5 (many diffs) n/a
Download CSV