Transcript: Mouse NM_001291282.1

Mus musculus transmembrane 6 superfamily member 1 (Tm6sf1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Tm6sf1 (107769)
Length:
1726
CDS:
214..1053

Additional Resources:

NCBI RefSeq record:
NM_001291282.1
NBCI Gene record:
Tm6sf1 (107769)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291282.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127252 CCTGATATAACGCTGGTCCAT pLKO.1 823 CDS 100% 2.640 3.696 N Tm6sf1 n/a
2 TRCN0000127253 CCTTACTTTGTGATTGCCCTT pLKO.1 769 CDS 100% 2.160 1.728 N Tm6sf1 n/a
3 TRCN0000127250 CCTGCTGCTTATCCTAAGATT pLKO.1 718 CDS 100% 5.625 3.938 N Tm6sf1 n/a
4 TRCN0000127249 GCAGCATACATGTGAGTGAAA pLKO.1 1151 3UTR 100% 4.950 3.465 N Tm6sf1 n/a
5 TRCN0000127251 GCCTGGAAACATCGTAGGAAA pLKO.1 405 CDS 100% 4.950 3.465 N Tm6sf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291282.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12020 pDONR223 100% 23.5% 19.8% None (many diffs) n/a
2 ccsbBroad304_12020 pLX_304 0% 23.5% 19.8% V5 (many diffs) n/a
3 TRCN0000480894 TTGCCTACGGTTGCTGGAAAACCC pLX_317 62.5% 23.5% 19.8% V5 (many diffs) n/a
Download CSV