Transcript: Human NM_001291316.2

Homo sapiens mast cell immunoglobulin like receptor 1 (MILR1), transcript variant S1, mRNA.

Source:
NCBI, updated 2019-04-10
Taxon:
Homo sapiens (human)
Gene:
MILR1 (284021)
Length:
1163
CDS:
55..801

Additional Resources:

NCBI RefSeq record:
NM_001291316.2
NBCI Gene record:
MILR1 (284021)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268567 TACTACTTCCAGGGTTATTAC pLKO_005 452 CDS 100% 13.200 18.480 N MILR1 n/a
2 TRCN0000268566 ATCACTGCAGATCACCTATTC pLKO_005 237 CDS 100% 10.800 7.560 N MILR1 n/a
3 TRCN0000283727 CATCTCAGGATGGAGTCTCAC pLKO_005 821 3UTR 100% 4.050 2.835 N MILR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05370 pDONR223 100% 72.3% 72.3% None 366_367ins285 n/a
2 ccsbBroad304_05370 pLX_304 0% 72.3% 72.3% V5 366_367ins285 n/a
3 TRCN0000477526 GACTTGTAGAAGAGTCAATGTATT pLX_317 45.6% 72.3% 72.3% V5 366_367ins285 n/a
4 ccsbBroadEn_13510 pDONR223 100% 58.8% 58.8% None 1_138del;366_367ins285 n/a
5 ccsbBroad304_13510 pLX_304 0% 58.8% 58.8% V5 1_138del;366_367ins285 n/a
6 TRCN0000474046 GCAAGGTCACAATTATATGTAAGT pLX_317 51.4% 58.8% 58.8% V5 1_138del;366_367ins285 n/a
Download CSV