Transcript: Human NM_001291501.2

Homo sapiens structural maintenance of chromosomes 1B (SMC1B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SMC1B (27127)
Length:
4011
CDS:
33..3518

Additional Resources:

NCBI RefSeq record:
NM_001291501.2
NBCI Gene record:
SMC1B (27127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151815 CCAGGAAGATATCTTACTGAA pLKO.1 3056 CDS 100% 4.950 6.930 N SMC1B n/a
2 TRCN0000152156 CCAGTTTCAGATGATAGTCAT pLKO.1 3338 CDS 100% 4.950 6.930 N SMC1B n/a
3 TRCN0000359556 AGTCAGCTGGATCGTTATAAA pLKO_005 1140 CDS 100% 15.000 10.500 N SMC1B n/a
4 TRCN0000156217 CGAAGAGGATGCACAGTTTAA pLKO.1 566 CDS 100% 13.200 9.240 N SMC1B n/a
5 TRCN0000359553 GGGAACTGTAGAGTCAATTTC pLKO_005 443 CDS 100% 13.200 9.240 N SMC1B n/a
6 TRCN0000155713 CAGTGAATGAACTCATGGCAA pLKO.1 2617 CDS 100% 2.640 1.848 N SMC1B n/a
7 TRCN0000155357 CATGGAGAAGTTCAGGGAAAT pLKO.1 1272 CDS 100% 10.800 6.480 N SMC1B n/a
8 TRCN0000159478 CACCTTAAGAAGAAACTGAAA pLKO.1 2511 CDS 100% 4.950 2.475 Y CT45A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11845 pDONR223 100% 99.9% 99.9% None 3148C>A n/a
2 ccsbBroad304_11845 pLX_304 0% 99.9% 99.9% V5 3148C>A n/a
3 TRCN0000480860 GTTGGACTCTATGCTTACAGCAAG pLX_317 12% 99.9% 99.9% V5 3148C>A n/a
Download CSV