Transcript: Human NM_001291951.2

Homo sapiens guanylate cyclase 1 soluble subunit beta 1 (GUCY1B1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
GUCY1B1 (2983)
Length:
3411
CDS:
121..2046

Additional Resources:

NCBI RefSeq record:
NM_001291951.2
NBCI Gene record:
GUCY1B1 (2983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063188 GCCTTGGACATGATGGAAATT pLKO.1 1684 CDS 100% 13.200 18.480 N GUCY1B1 n/a
2 TRCN0000327870 GCCTTGGACATGATGGAAATT pLKO_005 1684 CDS 100% 13.200 18.480 N GUCY1B1 n/a
3 TRCN0000312706 TATCTCTCACTATCCGTTATT pLKO_005 2188 3UTR 100% 13.200 18.480 N GUCY1B1 n/a
4 TRCN0000063190 CAGCCCATATACATTCTGCAA pLKO.1 810 CDS 100% 2.640 3.696 N GUCY1B1 n/a
5 TRCN0000312645 ATCACGCATCAGCCCATATAC pLKO_005 801 CDS 100% 13.200 9.240 N GUCY1B1 n/a
6 TRCN0000063192 GAAGGTTATTCAGCAAAGAAA pLKO.1 678 CDS 100% 5.625 3.938 N GUCY1B1 n/a
7 TRCN0000327796 GAAGGTTATTCAGCAAAGAAA pLKO_005 678 CDS 100% 5.625 3.938 N GUCY1B1 n/a
8 TRCN0000063189 CCTCCAAATGTTTGGGAAGAT pLKO.1 318 CDS 100% 4.950 3.465 N GUCY1B1 n/a
9 TRCN0000063191 GAACCAATGCAAGTTTGGTTT pLKO.1 1975 CDS 100% 0.495 0.347 N GUCY1B1 n/a
10 TRCN0000327871 GAACCAATGCAAGTTTGGTTT pLKO_005 1975 CDS 100% 0.495 0.347 N GUCY1B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291951.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06343 pDONR223 100% 96.5% 96.5% None 298_363del;1113G>A n/a
2 ccsbBroad304_06343 pLX_304 0% 96.5% 96.5% V5 298_363del;1113G>A n/a
3 TRCN0000491416 CGAAAAGATGCCAAGAGCTTAATC pLX_317 19% 96.5% 96.5% V5 298_363del;1113G>A n/a
Download CSV