Transcript: Human NM_001291962.2

Homo sapiens N-acetyltransferase 1 (NAT1), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
NAT1 (9)
Length:
2122
CDS:
295..1353

Additional Resources:

NCBI RefSeq record:
NM_001291962.2
NBCI Gene record:
NAT1 (9)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034946 CCCATAGGAGATTCAATTATA pLKO.1 1199 CDS 100% 15.000 21.000 N NAT1 n/a
2 TRCN0000296212 GATGTTGGGAGGGTATGTTTA pLKO_005 741 CDS 100% 13.200 10.560 N NAT1 n/a
3 TRCN0000344864 ACCCATAGGAGATTCAATTAT pLKO_005 1198 CDS 100% 15.000 10.500 N NAT1 n/a
4 TRCN0000312651 GTCATCCAGCTCACCAGTTAT pLKO_005 1383 3UTR 100% 13.200 9.240 N NAT1 n/a
5 TRCN0000312650 TCACCCATAGGAGATTCAATT pLKO_005 1196 CDS 100% 13.200 9.240 N NAT1 n/a
6 TRCN0000034947 ACTTAGGCTTAGAGGCCATTT pLKO.1 626 CDS 100% 10.800 7.560 N NAT1 n/a
7 TRCN0000289373 ACTTAGGCTTAGAGGCCATTT pLKO_005 626 CDS 100% 10.800 7.560 N NAT1 n/a
8 TRCN0000331084 ATCTACTCCTTTACTCTTAAG pLKO_005 1045 CDS 100% 10.800 7.560 N NAT1 n/a
9 TRCN0000296211 TCATCCAGCTCACCAGTTATC pLKO_005 1384 3UTR 100% 10.800 7.560 N NAT1 n/a
10 TRCN0000034944 GCCCAAACATGGTGATAGATT pLKO.1 1320 CDS 100% 5.625 3.938 N NAT1 n/a
11 TRCN0000034945 CCAAATCAGAAGGGAACAGTA pLKO.1 966 CDS 100% 4.950 3.465 N NAT1 n/a
12 TRCN0000344920 TTTGGAAGACTTAGGATATTA pLKO_005 1766 3UTR 100% 15.000 9.000 N NAT1 n/a
13 TRCN0000034948 CATCTCCATCATCTGTGTTTA pLKO.1 1112 CDS 100% 13.200 7.920 N NAT1 n/a
14 TRCN0000308126 TACTGGGCTCTGACCACTATT pLKO_005 706 CDS 100% 13.200 7.920 N NAT1 n/a
15 TRCN0000353788 ACTGGGCTCTGACCACTATTG pLKO_005 707 CDS 100% 10.800 6.480 N NAT1 n/a
16 TRCN0000308129 GTTCCCTTTGAGAACCTTAAC pLKO_005 583 CDS 100% 10.800 5.400 Y NAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00001 pDONR223 100% 82.3% 82.3% None 1_186del n/a
2 ccsbBroad304_00001 pLX_304 0% 82.3% 82.3% V5 1_186del n/a
3 TRCN0000470162 TGCCCTGTAAGGCGGGTTATTTCA pLX_317 47.9% 82.3% 82.3% V5 1_186del n/a
4 ccsbBroadEn_05750 pDONR223 100% 71.4% 66.4% None (many diffs) n/a
5 ccsbBroad304_05750 pLX_304 0% 71.4% 66.4% V5 (many diffs) n/a
6 TRCN0000479055 ACTCAAGAAAAGGAACTATAGATT pLX_317 50.5% 71.4% 66.4% V5 (many diffs) n/a
Download CSV