Transcript: Human NM_001291986.2

Homo sapiens bromodomain containing 2 (BRD2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
BRD2 (6046)
Length:
4853
CDS:
2025..4070

Additional Resources:

NCBI RefSeq record:
NM_001291986.2
NBCI Gene record:
BRD2 (6046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381007 GCTGCCCTATTCACTTCTAAG pLKO_005 4381 3UTR 100% 10.800 15.120 N BRD2 n/a
2 TRCN0000006309 GCCCTCTTTACGTGATTCAAA pLKO.1 3683 CDS 100% 5.625 7.875 N BRD2 n/a
3 TRCN0000315433 CCGGAAGCCCTACACCATTAA pLKO_005 3797 CDS 100% 13.200 10.560 N BRD2 n/a
4 TRCN0000023963 GCTTATGTTCTCCAACTGCTA pLKO.1 2921 CDS 100% 2.640 2.112 N Brd2 n/a
5 TRCN0000006311 CCTATGGACATGGGTACTATT pLKO.1 2022 5UTR 100% 13.200 9.240 N BRD2 n/a
6 TRCN0000273643 CCTATGGACATGGGTACTATT pLKO_005 2022 5UTR 100% 13.200 9.240 N BRD2 n/a
7 TRCN0000382148 GAAGATGGAGAACCGTGATTA pLKO_005 2867 CDS 100% 13.200 9.240 N BRD2 n/a
8 TRCN0000350645 GAGGGATGCAGGGACATTTAC pLKO_005 4217 3UTR 100% 13.200 9.240 N BRD2 n/a
9 TRCN0000350530 CTACCACTGTCCTCAACATTC pLKO_005 2365 CDS 100% 10.800 7.560 N BRD2 n/a
10 TRCN0000006310 CCCTGCCTACAGGTTATGATT pLKO.1 3541 CDS 100% 5.625 3.938 N BRD2 n/a
11 TRCN0000273689 CCCTGCCTACAGGTTATGATT pLKO_005 3541 CDS 100% 5.625 3.938 N BRD2 n/a
12 TRCN0000006312 CCTACCACTGTCCTCAACATT pLKO.1 2364 CDS 100% 5.625 3.938 N BRD2 n/a
13 TRCN0000006308 CCCTTTGCTGTGACACTTCTT pLKO.1 4146 3UTR 100% 4.950 3.465 N BRD2 n/a
14 TRCN0000195262 CTGATGATATTGTCCTAATGG pLKO.1 2140 CDS 100% 4.950 3.465 N BRD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291986.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488280 TTCTCATGCTTAGATCCGTCTCCC pLX_317 12.2% 84.9% 85% V5 (not translated due to prior stop codon) 0_1ins360;261C>T n/a
Download CSV