Transcript: Mouse NM_001293703.1

Mus musculus phospholipid phosphatase 5 (Plpp5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Plpp5 (71910)
Length:
1569
CDS:
43..723

Additional Resources:

NCBI RefSeq record:
NM_001293703.1
NBCI Gene record:
Plpp5 (71910)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001293703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080718 CCTCGCCAAGTTTCTAAGGAA pLKO.1 249 CDS 100% 3.000 4.200 N Plpp5 n/a
2 TRCN0000040240 CCCAGTGGACATTCTTCCTTT pLKO.1 475 CDS 100% 4.950 3.465 N PLPP5 n/a
3 TRCN0000080720 CCTAGCTCTGAATGGTGTCTT pLKO.1 318 CDS 100% 4.950 3.465 N Plpp5 n/a
4 TRCN0000080722 TCTGTGCCTTTCTGTCACCTT pLKO.1 584 CDS 100% 2.640 1.848 N Plpp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16036 pDONR223 0% 68.1% 69.8% None (many diffs) n/a
2 ccsbBroad304_16036 pLX_304 0% 68.1% 69.8% V5 (many diffs) n/a
3 ccsbBroadEn_12825 pDONR223 100% 64% 59.4% None (many diffs) n/a
4 ccsbBroad304_12825 pLX_304 0% 64% 59.4% V5 (many diffs) n/a
5 TRCN0000467220 ATTTTGTGCCGACTTTTCAACGTC pLX_317 59.3% 64% 59.4% V5 (many diffs) n/a
Download CSV