Transcript: Human NM_001294344.2

Homo sapiens myotubularin related protein 12 (MTMR12), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MTMR12 (54545)
Length:
4786
CDS:
102..2015

Additional Resources:

NCBI RefSeq record:
NM_001294344.2
NBCI Gene record:
MTMR12 (54545)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001294344.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218945 AGTGTCAACGAAGGCTATAAA pLKO_005 783 CDS 100% 15.000 21.000 N MTMR12 n/a
2 TRCN0000230374 CTAAACTGCTTAAACGATTAT pLKO_005 625 CDS 100% 13.200 18.480 N MTMR12 n/a
3 TRCN0000082644 CCGTAATGTTTGACACACTTA pLKO.1 706 CDS 100% 4.950 6.930 N MTMR12 n/a
4 TRCN0000230375 TGAATGTGCATTGACATATTT pLKO_005 4291 3UTR 100% 15.000 12.000 N MTMR12 n/a
5 TRCN0000082647 GCAAGAGAATTAGCAAACTTA pLKO.1 1546 CDS 100% 5.625 4.500 N MTMR12 n/a
6 TRCN0000082646 GCCACCCTATGAAATTGTTAA pLKO.1 1019 CDS 100% 13.200 9.240 N MTMR12 n/a
7 TRCN0000218390 TTGCCACTTACACAATCTAAG pLKO_005 1464 CDS 100% 10.800 7.560 N MTMR12 n/a
8 TRCN0000082643 GCCTTCTTAAATTAGCACTAA pLKO.1 4074 3UTR 100% 4.950 3.465 N MTMR12 n/a
9 TRCN0000230373 AGGATTGTCAGTGGCATAATT pLKO_005 588 CDS 100% 15.000 9.000 N MTMR12 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3517 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3518 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001294344.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12057 pDONR223 99.7% 91.9% 91.9% None 1343_1344ins168 n/a
2 ccsbBroad304_12057 pLX_304 0% 91.9% 91.9% V5 1343_1344ins168 n/a
3 TRCN0000466159 CAACCTATACCTGGAGATCATGTT pLX_317 20.8% 91.9% 91.9% V5 1343_1344ins168 n/a
Download CSV