Transcript: Human NM_001300730.2

Homo sapiens C-type lectin domain family 12 member A (CLEC12A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CLEC12A (160364)
Length:
1553
CDS:
189..830

Additional Resources:

NCBI RefSeq record:
NM_001300730.2
NBCI Gene record:
CLEC12A (160364)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061278 CCAAATTATGTCGTGAGCTAT pLKO.1 532 CDS 100% 4.950 6.930 N CLEC12A n/a
2 TRCN0000433798 GCATAAGGACAGCTGTTATTT pLKO_005 605 CDS 100% 15.000 10.500 N CLEC12A n/a
3 TRCN0000061282 CGTGGTATGAGAGTGGATAAT pLKO.1 789 CDS 100% 13.200 9.240 N CLEC12A n/a
4 TRCN0000061281 GCAAAGAACAAGAGCACAAAT pLKO.1 556 CDS 100% 13.200 9.240 N CLEC12A n/a
5 TRCN0000061279 GCAGCCTTGTTTCTGACTCTT pLKO.1 312 CDS 100% 4.950 3.465 N CLEC12A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300730.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13316 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13316 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469350 GACCTGCTATGTTGCCAATTCGCC pLX_317 64.1% 100% 100% V5 n/a
4 ccsbBroadEn_09730 pDONR223 100% 80.3% 80.3% None 639_640ins156 n/a
5 ccsbBroad304_09730 pLX_304 0% 80.3% 80.3% V5 639_640ins156 n/a
6 TRCN0000478724 TTACTTAGAATTTAAACTATGTTT pLX_317 44.8% 80.3% 80.3% V5 639_640ins156 n/a
Download CSV