Transcript: Human NM_001300807.1

Homo sapiens basic leucine zipper ATF-like transcription factor 2 (BATF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
BATF2 (116071)
Length:
2074
CDS:
136..888

Additional Resources:

NCBI RefSeq record:
NM_001300807.1
NBCI Gene record:
BATF2 (116071)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300807.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422428 AGTCCAAGGTCACGAAGACTT pLKO_005 1166 3UTR 100% 4.950 3.465 N BATF2 n/a
2 TRCN0000107400 CCCAGGATTTCACAGTCGAAA pLKO.1 1000 3UTR 100% 4.950 3.465 N BATF2 n/a
3 TRCN0000416461 CCTCTGCTCAAGTCCACTTCT pLKO_005 866 CDS 100% 4.950 3.465 N BATF2 n/a
4 TRCN0000421204 GGTCTTCCTCTAAGCTCAGTG pLKO_005 623 CDS 100% 4.050 2.835 N BATF2 n/a
5 TRCN0000107403 CTCTCCTGTTTGCCTCGCACA pLKO.1 584 CDS 100% 0.720 0.504 N BATF2 n/a
6 TRCN0000107402 GCCTCATGATTCTCCCAGCCT pLKO.1 486 CDS 100% 0.220 0.154 N BATF2 n/a
7 TRCN0000107404 GAGCACAAACCTGCTCTCTCA pLKO.1 778 CDS 100% 0.264 0.158 N BATF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300807.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15228 pDONR223 69.2% 75.2% 5.2% None 1_183del;201_202insN;204_205delAGinsNN n/a
2 ccsbBroad304_15228 pLX_304 0% 75.2% 5.2% V5 (not translated due to prior stop codon) 1_183del;201_202insN;204_205delAGinsNN n/a
3 TRCN0000491609 ACCGTTTCGCCACGCAATTAGTAT pLX_317 57.1% 75.2% 5.2% V5 (not translated due to prior stop codon) 1_183del;201_202insN;204_205delAGinsNN n/a
Download CSV