Transcript: Human NM_001300812.2

Homo sapiens fibroblast growth factor 22 (FGF22), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
FGF22 (27006)
Length:
1290
CDS:
32..529

Additional Resources:

NCBI RefSeq record:
NM_001300812.2
NBCI Gene record:
FGF22 (27006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300812.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413851 ATCCTGGAGATCCGCTCTGTA pLKO_005 248 CDS 100% 4.950 3.465 N FGF22 n/a
2 TRCN0000067430 CCTCTTCTCCTCCACTCACTT pLKO.1 163 CDS 100% 4.950 3.465 N Fgf22 n/a
3 TRCN0000058598 TGGTCATCAAAGCAGTGTCCT pLKO.1 282 CDS 100% 2.640 1.848 N FGF22 n/a
4 TRCN0000436817 GCAGTGTCCTCAGGCTTCTAC pLKO_005 293 CDS 100% 1.650 1.155 N FGF22 n/a
5 TRCN0000058600 CTCAGGCTTCTACGTGGCCAT pLKO.1 301 CDS 100% 0.720 0.504 N FGF22 n/a
6 TRCN0000058601 CCGGGAGCGCATCGAAGAGAA pLKO.1 353 CDS 100% 0.000 0.000 N FGF22 n/a
7 TRCN0000058599 CACTTCTTCCTGCGCGTGGAT pLKO.1 179 CDS 100% 0.880 0.528 N FGF22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300812.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475634 GGGAATGAGATGCCTTCGGCGATC pLX_317 26.8% 94% 64.3% V5 317_318ins23;488_495delTGAGGCCC n/a
2 ccsbBroadEn_08040 pDONR223 100% 93.8% 63.8% None 317_318ins23;422C>G;488_495delTGAGGCCC n/a
3 ccsbBroad304_08040 pLX_304 0% 93.8% 63.8% V5 317_318ins23;422C>G;488_495delTGAGGCCC n/a
Download CSV