Transcript: Human NM_001300948.3

Homo sapiens lon peptidase 2, peroxisomal (LONP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
LONP2 (83752)
Length:
8063
CDS:
90..2516

Additional Resources:

NCBI RefSeq record:
NM_001300948.3
NBCI Gene record:
LONP2 (83752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300948.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435709 GCAACGTACGACAGGATTTAA pLKO_005 2395 CDS 100% 15.000 21.000 N LONP2 n/a
2 TRCN0000423387 CCAGATTGTACAGGTCTTAAA pLKO_005 413 CDS 100% 13.200 18.480 N LONP2 n/a
3 TRCN0000414064 ACCATTACCTTAGTGGATTTA pLKO_005 2956 3UTR 100% 13.200 9.240 N LONP2 n/a
4 TRCN0000415696 ATGCCAGAGCAGGCCCATAAA pLKO_005 801 CDS 100% 13.200 9.240 N LONP2 n/a
5 TRCN0000417010 CATAACTTCACAGATCATTAT pLKO_005 1362 CDS 100% 13.200 9.240 N LONP2 n/a
6 TRCN0000046832 CCACTGCTTGTCAGACAAATT pLKO.1 603 CDS 100% 13.200 9.240 N LONP2 n/a
7 TRCN0000046830 CCCACTACACTCTGTTGATTA pLKO.1 376 CDS 100% 13.200 9.240 N LONP2 n/a
8 TRCN0000046829 CCTCAGTCAATGCCAGAATAT pLKO.1 858 CDS 100% 13.200 9.240 N LONP2 n/a
9 TRCN0000046831 GCCAGGAGTAGCAATAGGTTT pLKO.1 1916 CDS 100% 4.950 3.465 N LONP2 n/a
10 TRCN0000046828 GCCAACTATTCTTGGCTATAT pLKO.1 3042 3UTR 100% 1.320 0.924 N LONP2 n/a
11 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 3097 3UTR 100% 4.950 2.475 Y CENPL n/a
12 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 5107 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300948.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09113 pDONR223 100% 94.7% 94.7% None 468_469ins132;2416A>T n/a
2 ccsbBroad304_09113 pLX_304 0% 94.7% 94.7% V5 468_469ins132;2416A>T n/a
3 TRCN0000476793 CATAAACACCTAATGTCAAGTTCT pLX_317 14.1% 94.7% 94.7% V5 468_469ins132;2416A>T n/a
Download CSV