Transcript: Human NM_001300954.2

Homo sapiens alkaline ceramidase 3 (ACER3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ACER3 (55331)
Length:
7404
CDS:
416..934

Additional Resources:

NCBI RefSeq record:
NM_001300954.2
NBCI Gene record:
ACER3 (55331)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300954.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416941 AGTAACCTGATCATGATTATA pLKO_005 174 5UTR 100% 15.000 21.000 N ACER3 n/a
2 TRCN0000005228 CGGTACATTGCTTCTTATTTA pLKO.1 243 5UTR 100% 15.000 21.000 N ACER3 n/a
3 TRCN0000416099 CATTAGTACTTCGATCTATTT pLKO_005 594 CDS 100% 13.200 18.480 N ACER3 n/a
4 TRCN0000419387 AGTAACCACAGTTTACCTTAA pLKO_005 523 CDS 100% 10.800 15.120 N ACER3 n/a
5 TRCN0000420291 CCATAGACCTGGCAGAATAAA pLKO_005 970 3UTR 100% 15.000 12.000 N ACER3 n/a
6 TRCN0000005225 GCCAATTCTTTGAAGACCTTT pLKO.1 3014 3UTR 100% 4.950 3.960 N ACER3 n/a
7 TRCN0000421298 GCTCATGGCTTTATCTTATTT pLKO_005 1113 3UTR 100% 15.000 10.500 N ACER3 n/a
8 TRCN0000414579 ACAGTTTGTGCTGGTTATAAG pLKO_005 1233 3UTR 100% 13.200 9.240 N ACER3 n/a
9 TRCN0000005227 CATAGGTATTACCACACAATT pLKO.1 757 CDS 100% 13.200 9.240 N ACER3 n/a
10 TRCN0000427801 TATACAGCTGTTGCATATTTG pLKO_005 420 CDS 100% 13.200 9.240 N ACER3 n/a
11 TRCN0000124488 CCATCAGGTCATGTATGGAAT pLKO.1 562 CDS 100% 4.950 3.465 N Acer3 n/a
12 TRCN0000005229 GTTCCTATCTTCACATCCTTT pLKO.1 810 CDS 100% 4.950 3.465 N ACER3 n/a
13 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 6233 3UTR 100% 4.950 2.475 Y LOC387873 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4419 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300954.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08521 pDONR223 100% 64.2% 64.4% None 0_1ins285;141G>A n/a
2 ccsbBroad304_08521 pLX_304 0% 64.2% 64.4% V5 0_1ins285;141G>A n/a
3 TRCN0000475105 ACGGTCACAATAGTTTCCTGTTGG pLX_317 53.5% 64.2% 64.4% V5 0_1ins285;141G>A n/a
Download CSV