Construct: ORF TRCN0000475105
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004519.1_s317c1
- Derived from:
- ccsbBroadEn_08521
- DNA Barcode:
- ACGGTCACAATAGTTTCCTGTTGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ACER3 (55331)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475105
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55331 | ACER3 | alkaline ceramidase 3 | NM_018367.7 | 99.6% | 99.6% | 154G>A;183G>A;426G>A |
2 | human | 55331 | ACER3 | alkaline ceramidase 3 | XM_011545151.2 | 86.8% | 86.8% | (many diffs) |
3 | human | 55331 | ACER3 | alkaline ceramidase 3 | NM_001300953.2 | 86% | 85.7% | 103_104ins111;315G>A |
4 | human | 55331 | ACER3 | alkaline ceramidase 3 | XM_011545152.2 | 83.8% | 83.8% | (many diffs) |
5 | human | 55331 | ACER3 | alkaline ceramidase 3 | NM_001300954.2 | 64.2% | 64.4% | 0_1ins285;141G>A |
6 | human | 55331 | ACER3 | alkaline ceramidase 3 | NM_001300955.2 | 64.2% | 64.4% | 0_1ins285;141G>A |
7 | human | 55331 | ACER3 | alkaline ceramidase 3 | XM_011545153.2 | 61.4% | 61.4% | (many diffs) |
8 | human | 55331 | ACER3 | alkaline ceramidase 3 | XM_017017988.1 | 61.4% | 61.4% | (many diffs) |
9 | human | 55331 | ACER3 | alkaline ceramidase 3 | XM_017017987.1 | 56.6% | 54.6% | (many diffs) |
10 | human | 55331 | ACER3 | alkaline ceramidase 3 | XR_001747919.1 | 10.7% | (many diffs) | |
11 | human | 55331 | ACER3 | alkaline ceramidase 3 | XR_001747918.1 | 10.1% | (many diffs) | |
12 | mouse | 66190 | Acer3 | alkaline ceramidase 3 | NM_025408.2 | 88.5% | 88.7% | (many diffs) |
13 | mouse | 66190 | Acer3 | alkaline ceramidase 3 | XR_001777994.1 | 17.7% | (many diffs) | |
14 | mouse | 66190 | Acer3 | alkaline ceramidase 3 | XR_378263.3 | 17.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 867
- ORF length:
- 801
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tccggccgcg gaccgagagg gctactgggg ccccacgacc tccacgctgg 121 actggtgcga ggagaactac tccgtgacct ggtacatcgc cgagttctgg aatacagtga 181 gtaacctgat catgattata cctccaatgt tcggtgcaat tcagagtgtt agagacggtc 241 tggaaaaacg gtacattgct tcttatttag cactcacagt ggtaggaatg ggatcctggt 301 gcttccacat gactctgaaa tatgaaatgc agctattgga tgaactccca atgatataca 361 gctgttgcat atttgtgtac tgcatgtttg aatgtttcaa gatcaagaac tcagtaaact 421 accatctgct ttttaccTTA GTTCTATTCA GTTTAATAGT AACCACAGTT TACCTTAAGG 481 TAAAAGAGCC AATATTCCAT CAGGTCATGT ATGGAATGTT GGTCTTTACA TTAGTACTTC 541 GATCTATTTA TATTGTTACA TGGGTTTATC CATGGCTTAG AGGACTGGGT TATACATCAT 601 TGGGTATATT TTTATTGGGA TTTTTATTTT GGAATATAGA TAACATATTT TGTGAGTCAC 661 TGAGGAACTT TCGAAAGAAG GTACCACCTA TCATAGGTAT TACCACACAA TTTCATGCAT 721 GGTGGCATAT TTTAACTGGC CTTGGTTCCT ATCTTCACAT CCTTTTCAGT TTGTATACAA 781 GAACACTTTA CCTGAGATAT AGGCCAAAAG TGAAGTTTCT CTTTGGAATC TGGCCAGTGA 841 TCCTGTTTGA GCCTCTCAGG AAGCATTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 901 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 961 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAACGGTCAC 1021 AATAGTTTCC TGTTGGACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1081 aagatt