Transcript: Human NM_001300975.2

Homo sapiens ankyrin repeat domain 42 (ANKRD42), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
ANKRD42 (338699)
Length:
3310
CDS:
960..2543

Additional Resources:

NCBI RefSeq record:
NM_001300975.2
NBCI Gene record:
ANKRD42 (338699)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242937 GGATCCCAGTGTGACTGATAA pLKO_005 1409 CDS 100% 13.200 18.480 N ANKRD42 n/a
2 TRCN0000242936 ATGGGAGCAGACAGTAATATT pLKO_005 1917 CDS 100% 15.000 12.000 N ANKRD42 n/a
3 TRCN0000167036 CTAGAGGATCAGGAAACTTTA pLKO.1 1731 CDS 100% 13.200 10.560 N ANKRD42 n/a
4 TRCN0000242940 ACCTCAAATCTGATCTATTAA pLKO_005 2958 3UTR 100% 15.000 10.500 N ANKRD42 n/a
5 TRCN0000242939 AGTACGAGCTGGAGATGTAAA pLKO_005 1058 CDS 100% 13.200 9.240 N ANKRD42 n/a
6 TRCN0000242938 TGCTTGTGTACAGGCTCTTAT pLKO_005 1277 CDS 100% 13.200 9.240 N ANKRD42 n/a
7 TRCN0000166943 GAGGAGCTACAGAAATATGAT pLKO.1 2010 CDS 100% 5.625 3.375 N ANKRD42 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2637 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13580 pDONR223 100% 37.5% 37% None (many diffs) n/a
2 ccsbBroad304_13580 pLX_304 0% 37.5% 37% V5 (many diffs) n/a
3 TRCN0000492352 GTAGGAGCAACTAACCATCTCGGG pLX_317 45.8% 37.5% 37% V5 (many diffs) n/a
Download CSV