Transcript: Human NM_001300994.3

Homo sapiens TPD52 like 1 (TPD52L1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TPD52L1 (7164)
Length:
2200
CDS:
180..755

Additional Resources:

NCBI RefSeq record:
NM_001300994.3
NBCI Gene record:
TPD52L1 (7164)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338568 AGGTACACAACTGGTCATAAT pLKO_005 1001 3UTR 100% 13.200 18.480 N TPD52L1 n/a
2 TRCN0000338638 TAGGCGGTACGAACCCTAATG pLKO_005 634 CDS 100% 10.800 15.120 N TPD52L1 n/a
3 TRCN0000155521 GCAGAGTTAGTTCAGCTAGAA pLKO.1 300 CDS 100% 4.950 3.960 N TPD52L1 n/a
4 TRCN0000338635 GCAGAGTTAGTTCAGCTAGAA pLKO_005 300 CDS 100% 4.950 3.960 N TPD52L1 n/a
5 TRCN0000156453 CTCGGCATGAACCTGATGAAT pLKO.1 390 CDS 100% 5.625 3.938 N TPD52L1 n/a
6 TRCN0000150777 GCATGAACCTGATGAATGAAT pLKO.1 394 CDS 100% 5.625 3.938 N TPD52L1 n/a
7 TRCN0000338567 GCATGAACCTGATGAATGAAT pLKO_005 394 CDS 100% 5.625 3.938 N TPD52L1 n/a
8 TRCN0000158076 CTTCTCTAGCATGCTCTCTGA pLKO.1 257 CDS 100% 2.640 1.848 N TPD52L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300994.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01698 pDONR223 100% 70.8% 68.5% None (many diffs) n/a
2 ccsbBroad304_01698 pLX_304 0% 70.8% 68.5% V5 (many diffs) n/a
3 TRCN0000468399 GATCTATAGATACCTGTTGATCTT pLX_317 76.9% 70.8% 68.5% V5 (many diffs) n/a
Download CSV