Transcript: Human NM_001301146.2

Homo sapiens tripartite motif containing 69 (TRIM69), transcript variant e, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TRIM69 (140691)
Length:
1024
CDS:
178..969

Additional Resources:

NCBI RefSeq record:
NM_001301146.2
NBCI Gene record:
TRIM69 (140691)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230339 CTCGACAAGGTGGGCATATAC pLKO_005 784 CDS 100% 13.200 18.480 N TRIM69 n/a
2 TRCN0000056780 GTGGGCATATACCTGGATTAT pLKO.1 793 CDS 100% 13.200 18.480 N TRIM69 n/a
3 TRCN0000230337 TGGCAACCAGAGAGCTTATTT pLKO_005 326 CDS 100% 15.000 10.500 N TRIM69 n/a
4 TRCN0000230338 GCGTCTGGCATGGTGACATTA pLKO_005 497 CDS 100% 13.200 9.240 N TRIM69 n/a
5 TRCN0000218182 AGGAACCAAACTGATCTAAAG pLKO_005 721 CDS 100% 10.800 7.560 N TRIM69 n/a
6 TRCN0000056778 CCACTAACTCTGGACCCTAAA pLKO.1 436 CDS 100% 10.800 7.560 N TRIM69 n/a
7 TRCN0000218700 TTGTCAGAGAATCCATCATTC pLKO_005 647 CDS 100% 10.800 7.560 N TRIM69 n/a
8 TRCN0000056781 GCATGGTGACATTAAGAAGAT pLKO.1 504 CDS 100% 4.950 3.465 N TRIM69 n/a
9 TRCN0000056779 CCAGAGAGCTTATTTCCAGAA pLKO.1 332 CDS 100% 4.050 2.835 N TRIM69 n/a
10 TRCN0000056782 CTGAGGAACATGCAGAAGGAA pLKO.1 241 CDS 100% 3.000 2.100 N TRIM69 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04943 pDONR223 100% 77.1% 77.1% None 102_103ins234 n/a
2 ccsbBroad304_04943 pLX_304 0% 77.1% 77.1% V5 102_103ins234 n/a
3 TRCN0000479430 CTACTTTGACTGTACTCATTACCC pLX_317 32.1% 77.1% 77.1% V5 102_103ins234 n/a
Download CSV