Transcript: Mouse NM_001301298.1

Mus musculus growth factor receptor bound protein 2-associated protein 1 (Gab1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Gab1 (14388)
Length:
5006
CDS:
917..3094

Additional Resources:

NCBI RefSeq record:
NM_001301298.1
NBCI Gene record:
Gab1 (14388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100114 CAAGTCGAATACCTGGATTTA pLKO.1 2879 CDS 100% 13.200 18.480 N Gab1 n/a
2 TRCN0000335030 CAAGTCGAATACCTGGATTTA pLKO_005 2879 CDS 100% 13.200 18.480 N Gab1 n/a
3 TRCN0000100113 CGTCGATTCACCTTTCGCTAT pLKO.1 1321 CDS 100% 4.050 5.670 N Gab1 n/a
4 TRCN0000335028 CGTCGATTCACCTTTCGCTAT pLKO_005 1321 CDS 100% 4.050 5.670 N Gab1 n/a
5 TRCN0000100111 GCTAGTTCTCAAGATTGCTAT pLKO.1 2117 CDS 100% 4.950 3.960 N Gab1 n/a
6 TRCN0000100110 GCCTGCTCTTACTCCTGTTTA pLKO.1 3843 3UTR 100% 13.200 9.240 N Gab1 n/a
7 TRCN0000334955 GCCTGCTCTTACTCCTGTTTA pLKO_005 3843 3UTR 100% 13.200 9.240 N Gab1 n/a
8 TRCN0000100112 CCAGAGCAAACACGGAATGAA pLKO.1 1594 CDS 100% 5.625 3.938 N Gab1 n/a
9 TRCN0000335029 CCAGAGCAAACACGGAATGAA pLKO_005 1594 CDS 100% 5.625 3.938 N Gab1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301298.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00605 pDONR223 100% 84.7% 90.4% None (many diffs) n/a
2 ccsbBroad304_00605 pLX_304 0% 84.7% 90.4% V5 (many diffs) n/a
Download CSV