Transcript: Human NM_001301317.2

Homo sapiens tuftelin 1 (TUFT1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TUFT1 (7286)
Length:
3246
CDS:
141..1370

Additional Resources:

NCBI RefSeq record:
NM_001301317.2
NBCI Gene record:
TUFT1 (7286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005719 CCGGGAGGATATAAGTAGCAA pLKO.1 545 CDS 100% 3.000 4.200 N TUFT1 n/a
2 TRCN0000231075 AGAAGCTCCGGGAGGATATAA pLKO_005 538 CDS 100% 15.000 12.000 N TUFT1 n/a
3 TRCN0000231076 TGAGGTGGACACCTGTATAAA pLKO_005 674 CDS 100% 15.000 12.000 N TUFT1 n/a
4 TRCN0000218896 ATAGCCTTCTCTTGCAGTATT pLKO_005 2256 3UTR 100% 13.200 9.240 N TUFT1 n/a
5 TRCN0000231073 ATGGACATGAGGAGATCATTA pLKO_005 412 CDS 100% 13.200 9.240 N TUFT1 n/a
6 TRCN0000005718 CGGATGGAACACCTGATAGAA pLKO.1 1224 CDS 100% 5.625 3.938 N TUFT1 n/a
7 TRCN0000005717 CCTTGCTCCATAATTGGTCTT pLKO.1 2528 3UTR 100% 4.050 2.835 N TUFT1 n/a
8 TRCN0000005721 GAACAAAGTAATGTGGCCCTT pLKO.1 822 CDS 100% 2.160 1.512 N TUFT1 n/a
9 TRCN0000231074 GATTCACGAGAAGAATATTAA pLKO_005 467 CDS 100% 15.000 9.000 N TUFT1 n/a
10 TRCN0000005720 GCAGAGAATTTAGAGATGCAT pLKO.1 1200 CDS 100% 3.000 1.800 N TUFT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01727 pDONR223 100% 93.3% 90.7% None (many diffs) n/a
2 ccsbBroad304_01727 pLX_304 0% 93.3% 90.7% V5 (many diffs) n/a
3 TRCN0000468637 CAATGCCATCCCTGTATGGGATCA pLX_317 37.6% 93.3% 90.7% V5 (many diffs) n/a
4 ccsbBroadEn_15616 pDONR223 0% 88% 84% None (many diffs) n/a
5 ccsbBroad304_15616 pLX_304 0% 88% 84% V5 (many diffs) n/a
6 TRCN0000469800 AAGAGAAACTATGATTGGGCAAAT pLX_317 45.2% 88% 84% V5 (many diffs) n/a
Download CSV