Transcript: Mouse NM_001301644.1

Mus musculus phosphatidylinositol transfer protein, beta (Pitpnb), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pitpnb (56305)
Length:
2816
CDS:
306..902

Additional Resources:

NCBI RefSeq record:
NM_001301644.1
NBCI Gene record:
Pitpnb (56305)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348300 CCTAGGATGTGTGCCTATAAG pLKO_005 648 CDS 100% 13.200 18.480 N Pitpnb n/a
2 TRCN0000100588 GTCCTGAAGAATGAACCTTAT pLKO.1 210 5UTR 100% 10.800 15.120 N Pitpnb n/a
3 TRCN0000334288 GTCCTGAAGAATGAACCTTAT pLKO_005 210 5UTR 100% 10.800 15.120 N Pitpnb n/a
4 TRCN0000100585 GCCACTATCTTCCAGCCAAAT pLKO.1 1663 3UTR 100% 10.800 7.560 N Pitpnb n/a
5 TRCN0000334220 GCCACTATCTTCCAGCCAAAT pLKO_005 1663 3UTR 100% 10.800 7.560 N Pitpnb n/a
6 TRCN0000100586 CCTGCATTTGTGAGGATGATT pLKO.1 291 5UTR 100% 5.625 3.938 N Pitpnb n/a
7 TRCN0000156275 CCAGCAGACTACAAAGCTGAT pLKO.1 537 CDS 100% 4.050 2.835 N PITPNB n/a
8 TRCN0000344283 CCAGCAGACTACAAAGCTGAT pLKO_005 537 CDS 100% 4.050 2.835 N PITPNB n/a
9 TRCN0000100589 GAACTTACATCGCCAGCTCTT pLKO.1 752 CDS 100% 4.050 2.835 N Pitpnb n/a
10 TRCN0000100587 CAGAGCAAAGTAGAGAACTTT pLKO.1 702 CDS 100% 0.563 0.394 N Pitpnb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02839 pDONR223 100% 67.4% 70.8% None (many diffs) n/a
2 ccsbBroad304_02839 pLX_304 0% 67.4% 70.8% V5 (many diffs) n/a
3 TRCN0000476324 CATATATGCGCCAATTGACGGGCC pLX_317 52.5% 67.4% 70.8% V5 (many diffs) n/a
4 ccsbBroadEn_11758 pDONR223 100% 65.1% 69.1% None (many diffs) n/a
5 ccsbBroad304_11758 pLX_304 0% 65.1% 69.1% V5 (many diffs) n/a
6 TRCN0000473348 CCACGAACCCGACGTCCAATGATG pLX_317 50.1% 65.1% 69.1% V5 (many diffs) n/a
Download CSV