Transcript: Mouse NM_001301671.1

Mus musculus small ubiquitin-like modifier 3 (Sumo3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Sumo3 (20610)
Length:
2756
CDS:
351..683

Additional Resources:

NCBI RefSeq record:
NM_001301671.1
NBCI Gene record:
Sumo3 (20610)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098835 GCTTTCCAAGTGTGTATTAAA pLKO.1 1532 3UTR 100% 15.000 10.500 N Sumo3 n/a
2 TRCN0000302829 GCTTTCCAAGTGTGTATTAAA pLKO_005 1532 3UTR 100% 15.000 10.500 N Sumo3 n/a
3 TRCN0000098836 GTTGTCCTGACCTGTGCTATT pLKO.1 661 CDS 100% 10.800 7.560 N Sumo3 n/a
4 TRCN0000098838 CCCACTGAGCAAGCTGATGAA pLKO.1 461 CDS 100% 4.950 3.465 N Sumo3 n/a
5 TRCN0000302828 CCCACTGAGCAAGCTGATGAA pLKO_005 461 CDS 100% 4.950 3.465 N Sumo3 n/a
6 TRCN0000098839 CCGGTTTGATGGACAACCAAT pLKO.1 527 CDS 100% 4.950 3.465 N Sumo3 n/a
7 TRCN0000302908 CCGGTTTGATGGACAACCAAT pLKO_005 527 CDS 100% 4.950 3.465 N Sumo3 n/a
8 TRCN0000007650 GACAGAGAATGACCACATCAA pLKO.1 383 CDS 100% 4.950 3.465 N SUMO3 n/a
9 TRCN0000098837 GAAGACAGAGAATGACCACAT pLKO.1 380 CDS 100% 4.050 2.835 N Sumo3 n/a
10 TRCN0000302827 GAAGACAGAGAATGACCACAT pLKO_005 380 CDS 100% 4.050 2.835 N Sumo3 n/a
11 TRCN0000007651 GAATGACCACATCAACCTGAA pLKO.1 389 CDS 100% 4.050 2.430 N SUMO3 n/a
12 TRCN0000318642 GAATGACCACATCAACCTGAA pLKO_005 389 CDS 100% 4.050 2.430 N SUMO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06980 pDONR223 100% 77.5% 77.1% None (many diffs) n/a
2 ccsbBroad304_06980 pLX_304 0% 77.5% 77.1% V5 (many diffs) n/a
3 TRCN0000469913 TTTGCAATAAGATCTTTCACCTAA pLX_317 96.3% 77.5% 77.1% V5 (many diffs) n/a
4 ccsbBroadEn_06981 pDONR223 100% 66.9% 76.5% None (many diffs) n/a
5 ccsbBroad304_06981 pLX_304 0% 66.9% 76.5% V5 (many diffs) n/a
6 TRCN0000470007 AATTGCTGCTGCCGCCGTGGAATT pLX_317 95% 66.9% 76.5% V5 (many diffs) n/a
7 ccsbBroadEn_01558 pDONR223 100% 66.9% 77.4% None (many diffs) n/a
8 ccsbBroad304_01558 pLX_304 0% 66.9% 77.4% V5 (many diffs) n/a
Download CSV