Transcript: Human NM_001301772.2

Homo sapiens glycosylphosphatidylinositol anchored high density lipoprotein binding protein 1 (GPIHBP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
GPIHBP1 (338328)
Length:
585
CDS:
51..428

Additional Resources:

NCBI RefSeq record:
NM_001301772.2
NBCI Gene record:
GPIHBP1 (338328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301772.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165678 GATGACTACGACGAGGAAGAT pLKO.1 156 CDS 100% 4.950 2.970 N GPIHBP1 n/a
2 TRCN0000165589 GAGGAAGATGAGGATGAGGTT pLKO.1 168 CDS 100% 2.640 1.320 Y GPIHBP1 n/a
3 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 121 CDS 100% 4.950 2.475 Y Adam32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301772.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10001 pDONR223 100% 67.9% 67.9% None 375_376ins177 n/a
2 ccsbBroad304_10001 pLX_304 0% 67.9% 67.9% V5 375_376ins177 n/a
3 TRCN0000472359 GATGAGAACCGAAAAGTCCGTCTC pLX_317 63.2% 67.9% 67.9% V5 375_376ins177 n/a
4 ccsbBroadEn_16156 pDONR223 0% 67.5% 67.3% None 41T>G;138G>T;375_376ins177 n/a
5 ccsbBroad304_16156 pLX_304 0% 67.5% 67.3% V5 41T>G;138G>T;375_376ins177 n/a
Download CSV